Journal of Prevention and Treatment for Stomatological Diseases ›› 2018, Vol. 26 ›› Issue (6): 370-373.doi: 10.12016/j.issn.2096-1456.2018.06.006

• Basic Study • Previous Articles     Next Articles

Expression of periodontal ligament cell population miR-155 in patients with chronic periodontitis

Hua ZHAO1(), Xianing LI2, Xianli ZENG3, Hongyu ZHAO4()   

  1. 1. Stomatological Hospital, Southern Medical University, Guangzhou 510261, China
    2. Department of Periodontics, The First Affiliated Hospital of Zhengzhou University·School of Stomatology Zhengzhou University, Zhengzhou 450052, China
    3. Shenzhen Stomatological Hospital of Southern Medical University , Shenzhen 518005, China
    4. The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, China
  • Received:2017-06-11 Revised:2018-02-25 Online:2018-06-20 Published:2018-08-30

Abstract:

Objective To understand the expression of miR-155 in the periodontal ligament cell population of patients with chronic periodontitis. Methods Periodontal ligament cells from the teeth of patients (n = 11) with chronic periodontitis were isolated and cultured, as were periodontal ligament cells from intact teeth obtained from healthy patients (n = 13) who had been treated with orthodontic extraction (the control group). The expression level of miR-155 in the two groups of periodontal ligament cell populations was detected by real-time fluorescence-based quantitative PCR. Results The periodontal ligament cell expression level of miR-155 was significantly higher in the chronic periodontitis group (0.93 ± 0.12) than in the control group (0.76 ± 0.25) (P < 0.01). Conclusion miR-155 expression in periodontal ligament cells was obviously stronger in patients with chronic periodontitis.

Key words: Chronic periodontitis, Periodontal ligament cell population, Micro RNA, Micro-155, Regulate

CLC Number: 

  • R781.4

Table 1

Gene primer sequences"

Gene Sequence(5’-3’)
β-actin-上游引物 ATCGTGCGTGACATTAAGGAGAAG
β-actin-下游引物 AGGAAGGAAGGCTGGAAGAGTG
miR-155-RNA模板引物 GCGTATCCAGTGCAGGGTCCGAGGTAGGCGCACTGGATAGACCCCCTA
miR-155-上游引物 CGTTAATGCTAATCGTGATAG
miR-155-下游引物 GCAGGGTCCGAGGT

Figure 1

Morphological appearance of periodontal ligament cells in the experimental and control groups × 40"

Figure 2

Immunohistochemical staining of periodontal ligament cells × 200"

[1] Gao L, Jiang F.MicroRNA (miRNA) Profiling[J]. Methods Mol Biol. 2016, 1381: 151-161.
[2] Chen QS, Li M, Zhang ZC, et al.Integrated mRNA and microRNA analysisi dentifies genes and small miRNA molecules associated with transcriptional and post-transcriptional-level responses to both drought stress and re-watering treatment in tobacco[J]. Bmc Genomics, 2017, 18(1) : 62.
[3] Thome AD, Harms AS, Volpicelli-Daley LA, et al.MicroRNA-155 regulates alpha-synuclein-induced inflammatory responses in models of parkinson disease[J]. J Neurosci. 2016, 36(8): 2383-2390.
[4] Mantuano E, Brifault C, Lam MS, et al.LDL receptor-related protein-1 regulates NFκB and microRNA-155 in macrophages to control the inflammatory response[J]. Proc Natl Acad Sci U S A. 2016,113(5): 1369-1374.
[5] Wagshal D, Knowlton BJ, Cohen JR, et al.Impaired automatization of a cognitive skill in first -degree relatives of patients with schizophrenia[J]. Psychiatry research, 2014, 215(2): 294-299.
[6] Olsen I, Yilmaz Ö.Modulation of inflammasome activity by porphyromonas gingivalis in periodontitis and associated systemic diseases[J].J Oral Microbiol. 2016,8(4): 30385.
[7] Nares S, Moutsopoulos NM, Angelov N, et al.Rapid myeloid cell transcriptional and proteomic responses to periodontopathogenic porphyromonas gingivalis[J]. Am J Pathol,2009,174(4): 1400-1414.
[8] Nazarijahantigh M, Egea V, Schober A, et al.MicroRNA-specific regulatory mechanisms in atherosclerosis[J]. J Mol Cell Cardiol, 2015, 89(Pt A): 35-41.
[9] Sun HX, Zeng DY, Li RT, et al.Essential role of microRNA-155 in regulating endothelium-dependent vasorelaxation by targeting endothelial nitric oxide synthase[J]. Hypertension, 2012,60(6):1407-1414.
[10] Adriana DB, Isabella G, Silvia C, et al.Periodontal Disease: linking the primary inflammation to bone loss[J]. Clin Dev Immunol. 2016, 2013(4) : 503754.
[11] Banu S, Jabir NR, Mohan R, et al.Correlation of Toll-like receptor 4, interleukin-18, transaminases, and uric acid in patients with chronic periodontitis and healthy adults[J]. J Periodontol, 2015, 86(3): 431-439.
[12] Simpson LJ, Ansel KM.MicroRNA regulation of lymphocyte tolerance and autoimmunity[J]. J Clin Invest, 2015, 125(6): 2242-2249.
[13] Vigorito E, Kohlhaas S, Lu D, et al.MiR-155: an ancient regulator of the immune system[J]. Immunol Rev, 2013, 253(1): 146-157.
[1] LU Weiying,LIU Ping,CHEN Jiawei,LIU Shuying,XU Pingping. Effects of X-ray irradiation on proliferation and RANTES expression of the mouse osteogenic precursor cell line MC3T3-E1 [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(10): 621-626.
[2] Zhenzhe LIU,Liang ZHAO,Huairong HUANG,Wenxia HUANG,Hongbai CHEN. Study of the Er: YAG laser in periodontal flap surgery for the treatment of chronic periodontitis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(9): 574-577.
[3] Peisen LI, He LI, Qiujuan LIANG, Yan LI. Clinical value of serum markers of type 2 diabetes mellitus complicated by chronic periodontitis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(7): 456-459.
[4] Jun SHEN, Wenxia MENG, Xiao JIANG, Xuan WANG, Cao YIN. An analysis of periodontal status in desquamative gingivitis and the correlative factors [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(3): 171-174.
[5] Wei-ni XIN, Zhi-duo HOU, Yao GONG. Relationship of clinical index between rheumatoid arthritis and chronic periodontitis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(4): 227-230.
[6] Jing LI, Jing LIANG, Ting XU, Fengqing TAN, Juan LIU, Xiongqun ZENG. Relationship between interleukin-6 -572 gene polymorphism and aggressive periodontitis in Chinese [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(11): 718-722.
[7] Hua ZHANG. The short-term efficacy of implant in the treatment of patients with dentition defect caused by chronic periodontitis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(10): 652-655.
[8] LI Zhi-qiang,ZOU Rui,OUYANG Ke-xiong,BAI Zhi-bao,AI Wei-jian. Study on the role of long non-coding RNA TUG1 in tongue squamous cell carcinoma [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(9): 511-514.
[9] Dan WANG,Jia NI,Yuan SU,Dong-ying XUAN,Jin-cai ZHANG. Effects of chronic periodontitis on renal function in OLETF rats [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(8): 445-448.
[10] Ce ZHU,Hai-xia LU,Fei LI,Xi-ping FENG. Relationship between maternal chronic periodontitis and coinfection of Epstein-Barr virus and Porphyromonas gingivalis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(6): 325-330.
[11] Feng-zhou LI,Fan XUE. A short-term clinical effect observation of Er:YAG laser assisted treatment of chronic periodontitis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(3): 170-173.
[12] Juan LI,Ting HUANG,Wen XUE,Hai-yan LI. Clinical efficacy of basic periodontal therapy combined with local medication for erosive oral lichen planus [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(3): 162-165.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
[1] Hong-chang LAI,Jun-yu SHI. Maxillary sinus floor elevation[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(1): 8 -12 .
[2] Pin ZHOU, Yang-fei LI. MRI study of temporomandibular joint disc position in asymptomatic volunteers[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(4): 239 -244 .
[3] Xinxin XIA, Fang FANG, Lijuan CHENG. Shaping ability of Pathfile and WaveOne in simulated root canals[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(6): 365 -368 .
[4] Yuanhong LI, Xinyi FANG, Yu QIU, Lei CHENG. Experimental study on the effects of green tea on salivary flow rate and pH value[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(9): 560 -564 .
[5] Chengzhang LI. Masticatory muscles in occlusion[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(12): 755 -760 .
[6] . [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(1): 1 .
[7] Zhirong WU, Shiguang Huang. Research progress on the etiology, clinical examination and treatment of peri-implantitis[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(6): 401 -405 .
[8] Xiaowu YAO, Shisheng CHEN, Zizheng LU, Minxiao LIN. Clinical report and literature review on the amyloidosis of salivary glands[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(8): 533 -536 .
[9] Lan LIAO, Lijun ZENG. Updated research on digitalization in aesthetic restoration[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(7): 409 -414 .
[10] Yu LU, Chengxia LIU, Zhongjun LIU. Role of TRAF6 in inflammatory responses of human osteoblast-like cells with Enterococcusfaecalis[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(7): 420 -425 .
This work is licensed under a Creative Commons Attribution 3.0 License.