Journal of Prevention and Treatment for Stomatological Diseases ›› 2020, Vol. 28 ›› Issue (3): 153-157.doi: 10.12016/j.issn.2096-1456.2020.03.003

• Basic Study • Previous Articles     Next Articles

Knockdown of circ_0001273 inhibits the proliferation, migration and invasion of oral squamous cell carcinoma cells

ZENG Fantao1,YU Dongsheng2()   

  1. 1. Department of Stomatology, the Second Affiliated Hospital of Guangzhou Medical University, Guangzhou 510260, China
    2. Hospital of Stomatology, Guanghua School of Stomatology, Sun Yat-sen University, Guangdong Provincial Key Laboratory of Stomatology, Guangzhou 510055, China
  • Received:2019-09-10 Revised:2019-11-07 Online:2020-03-20 Published:2020-03-20
  • Contact: Dongsheng YU E-mail:yudsh@mail.sysu.edu.cn

Abstract:

Objective To explore the effect of circ_0001273 on the proliferation, migration and invasion of oral squamous cell carcinoma(OSCC) cells and to provide a relevant research basis for the use of targeted therapy in OSCC. Methods Data from twelve patients with a clinical diagnosis of OSCC were collected from tumor specimens and adjacent tissues. qRT-PCR was used to detect the expression levels of circ_0001273, circ_0018569, circ_0027152, and circ_0001273 which had the highest difference in expression in cancer and adjacent tissues was selected. siRNA was used for the knockdown of circ_0001273 in two types of OSCC cell lines, UM1 and CAL27, and the effects on the proliferation, migration, and invasion of UM1 and CAL27 cells were measured by MTS and Transwell experiments, respectively. Results The expression of circ_0001273 was abnormally increased in the 12 OSCC tissues (P < 0.05). After knocking down circ_0001273 in UM1 and CAL27 cells, the proliferation, migration and invasion abilities of UM1 and CAL27 cells were significantly reduced (P < 0.05). Conclusion The knockdown of circ_0001273 can inhibit the proliferation, migration and invasion of OSCC cells.

Key words: oral squamous cell carcinoma cells, squamous cell, carcinoma, circRNA, circ_0001273, OSCC cell lines UM1, OSCC cell lines CAL27, proliferation, migration, invasion

CLC Number: 

  • R78

Table 1

Primer sequences"

circRNA Sequence(5′→3′)
hsa_circ_0001273-F CCACCTCCAATGACAGACTT
hsa_circ_0001273-R CACACCTTAGCTGCTGACAC
hsa_circ_0018569-F TCAAGGACGCACTATCATCT
hsa_circ_0018569-R CCGCTGTAAACATGATGGAA
hsa_circ_0027152-F CTGCGACGGGGACAATGACTG
hsa_circ_0027152-R GGCCCATCGTCCGTCCAGTAC
18srRNA-F CCTGGATACCGCAGCTAGGA
18srRNA-R GCGGCGCAATACGAATGCCCC

Figure 1

Relative expression of circ_0001273, circ_0018569, circ_0027152 in 12 oral squamous cell carcinoma and adjacent tissues ***: P < 0.001. NOR: adjacent tissues; CAN: cancer tissues"

Figure 2

Relative expression of circ_0001273 in 4 groups of oral squamous cell carcinoma cells after knockdown of circ_0001273"

Figure 3

Effect of circ_0001273 siRNA on the proliferation of UM1 and CAL27 cells"

Figure 4

Effect of circ_0001273 siRNA on the migration ability of UM1 and CAL27 cells **: P < 0.01. Magnification: × 100"

Figure 5

Effect of circ_0001273 siRNA on the invasion ability of UM1 and CAL27 cells **: P < 0.01. Magnification: × 100"

[1] Rhodus NL, Kerr AR, Patel K . Oral cancer: leukoplakia, premalignancy, and squamous cell carcinoma[J]. Dent Clin North Am, 2014,58(2):315-340.
[2] Salzman J, Gawad C, Wang PL , et al. Circular RNAs are the predominant transcript isoform from hundreds of human genes in diverse cell types[J]. PLoS One, 2012,7(2):e30733.
[3] Chen L, Zhang S, Wu J , et al. circRNA_100290 plays a role in oral cancer by functioning as a sponge of the miR-29 family[J]. Oncogene, 2017,36(32) : 4551-4561.
[4] Wu Y, Zhang Y, Zhang Y , et al. CircRNA hsa_circ_0005105 upregulates NAMPT expression and promotes chondrocyte extracellular matrix degradation by sponging miR-26a[J]. Cell Biol Int, 2017,41(12):1283-1289.
[5] Cardamone G, Parabschi EM, Rimoldi V , et al. The characterization of GSDMB splicing and back splicing profiles identifies novel isoforms and a circular RNA that are dysregulated in multiple sclerosis[J]. Int J Mol Sci, 2017,18(3):e576.
[6] Burd CE, Jeck WR, Liu Y , et al. Expression of linear and novelcircular forms of an INK4/ARF-associated non-coding RNA correlates with atherosclerosis risk[J]. PLoS Genet, 2010,6(12):e1001233.
[7] Momen-Heravi F, Bala S . Emerging role of non-coding RNA in oral cancer[J]. Cell Signal, 2018,42:134-143.
[8] Zhu M, Xu Y, Chen Y , et al. Circular BANP, an upregulated circular RNA that modulates cell proliferarion in colorectal cancer[J]. Biomed Pharmacother, 2017,88:138-144.
[9] Li C, Li M, Xue Y . Downregulation of circRNA CDR1 as specifically triggered low-dose diosbulbin-B induced gastric cancer cell death by regulating miR-7-5p/REGγ axis[J]. Biomed Pharmacother, 2019,120:109462.
[10] Li B, Li X . Overexpression of hsa_circ_0007534 predicts unfavorable prognosis for osteosarcoma and regulates cell growth and apoptosis by affecting AKT/GSK-3β signaling pathway[J]. Biomed Pharmacother, 2018,107:860-866.
[11] Yao Y, Hua Q, Zhou Y . CircRNA has_circ_0006427 suppresses the progression of lung adenocarcinoma by regulating miR-6783-3p/DKK1 axis and inactivating Wnt/β-catenin signaling pathway[J]. Biochem Biophys Res Commun, 2019,508(1):37-45.
[12] Xie B, Zhao Z, Liu Q , et al. CircRNA has_circ_0078710 acts as the sponge of microRNA-31 involved in hepatocellular carcinoma progression[J]. Gene, 2019,683:253-261.
[13] Cao S, Chen G, Yan L , et al. Contribution of dysregulated circRNA_100876 to proliferation and metastasis of esophageal squamous cell carcinoma[J]. Onco Targets Ther, 2018,11:7385-7394.
[14] Wang S, Li Q, Wang Y , et al. Upregulation of circ-UBAP2 predicts poor prognosis and promotes triple-negative breast cancer progression through the miR-661/MTA1 pathway[J]. Biochem Biophys Res Commun, 2018,505(4):996-1002.
[15] Wang L, Wei Y, Yan Y , et al. CircDOCK1 suppresses cell apoptosis via inhibition of miR-196a-5p by targeting BIRC3 in OSCC[J]. Oncol Rep, 2018,39(3):951-966.
[1] ZHONG qijian,JIN Tingting,PENG Yu,CHEN Weixiong,LI Jinsong. The effect of silencing the endoplasmic reticulum stress-related protein calnexin on the proliferation, invasion, and migration of tongue squamous cell carcinoma cells [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(8): 535-540.
[2] WANG Qianqian,DING Dandan,DING Xiang,HAN Rui,HAN Yingying,ZHOU Meiyun,XU Jincheng. Expression of Bex1 and NF-kBp65 in tongue squamous cell carcinoma and its significance [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(6): 383-387.
[3] ZHANG Shuguang,YIN Xiteng,XU Wenguang,HAN Wei,LIU Zhe. Clinical analysis of 22 cases of lymphoepithelial carcinoma of parotid gland [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(6): 400-405.
[4] XU Siming,SONG Yuhan,SHAO Yanxiong,TAO Lan,ZHOU Haiwen. Differential expression profile of circRNAs in oral leukoplakia [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(5): 296-305.
[5] LI Ming,NAN Xinrong,YUAN Zhenying,TANG Zhangui. Accuracy analysis of MRI in the depth of invasion assessment of tongue squamous cell carcinoma [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(5): 322-327.
[6] WANG Min,JIANG Nan,ZHU Songsong. A novel biomimetic micro/nano hierarchical interface of titanium enhances adhesion, proliferation and osteogenic differentiation of bone marrow mesenchymal cells [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(4): 226-233.
[7] WANG Anxun. Detection and significance of immune function in oral mucosa-associated diseases [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(2): 73-80.
[8] YAN Shanyu,MEI Hongxiang,LI Juan. Role of mesenchymal stem cells migration in bone injury repair [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(12): 854-858.
[9] CHEN Zhen,ZHANG Wenbo,PENG Xin. Research progress on the neck management of oral squamous cell carcinoma with clinically node-positive neck [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(11): 776-781.
[10] SUN Jingxuan,LI Yanping,PAN Shuang,HE Lina,SUN Xiangyu,ZHANG Shuang,NIU Yumei. Effects of graphene on the proliferation, migration and morphology of dental pulp stem cells [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(10): 656-662.
[11] WANG Guangchao,LIU Lijun,JIANG Weiwen. Significance of phosphoinositol metabolism by DNA methylation may contribute in oral leukoplakia carcinogenesis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(10): 677-683.
[12] ZENG Fei,LU Jie,SUN Renhao,FANG Yikang,YU Wenyi,YANG Fang,ZHAO Lu. Research progress on programmed death receptor 1/ ligand 1 inhibitor in immunotherapy of head and neck squamous cell carcinoma [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(10): 706-710.
[13] WANG Liye,GAO Ying,TIAN Chun. Identification of potential genetic markers in prognosis of oral squamous cell carcinoma patients by bioinformatic analysis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(1): 27-33.
[14] CHEN Yongju,HUANG Zixian,CHEN Rui,CHEN Weiliang. Research progress on HPV-positive oropharyngeal carcinoma sensitive to radiation therapy [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(1): 65-68.
[15] YANG Jin,WU Feifei,GAO Qinghong,LI Xiaoyu,MANABU Kato,CHENG Ran,ZHOU Hongmei. Effects of TGF-β1 on the migration of oral cancer-associated fibroblasts in two and three dimensional co-culture models [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(9): 562-568.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
[1] ZHU Song-song, HU Jing. The application of distraction osteogenesis in the temporomandibular joint ankylosis and secondary dentofacial deformities[J]. journal1, 2016, 24(1): 6 -10 .
[2] XU Jing. The influence of the impacted mandibular third molar extraction on the distal periodontal tissue of the mandibular second molar[J]. journal1, 2016, 24(1): 11 -14 .
[3] ZHONG Jiang-long, PAN Ji-yang, CHEN Wei-liang. The evaluation of Eagle syndrome treatment by surgery combined with antidepressant therapy[J]. journal1, 2016, 24(1): 26 -28 .
[4] CHEN Xi, SUN Qin-zhou. The study of colorimetric board of porcelain fused to metal restoration for moderate to severe dental fluorosis[J]. journal1, 2016, 24(1): 33 -36 .
[5] OUYANG Ke-xiong1, LIANG Jun, ZOU Rui, LI Zhi-qiang, BAI Zhi-bao, PIAO Zheng-guo, ZHAO Jian-Jiang.. Ion Torrent RNA-Seq detection and analysis of the long non-coding RNA in tongue squamous cell carcinoma[J]. journal1, 2016, 24(1): 15 -19 .
[6] YU Pei, XUE Jing, ZHANG Xiao-wei, ZHENG Cang-shang. The influence of the roughness of zirconia ceramic surface on microbial attachment[J]. journal1, 2016, 24(1): 20 -25 .
[7] LIU Fang. Clinical assessment of two fissure sealant techniques in children’s dental caries prevention[J]. journal1, 2016, 24(1): 44 -45 .
[8] . [J]. journal1, 2016, 24(1): 49 -52 .
[9] LU Jian-rong, BAN Hua-jie, WANG Dai-you, ZHOU Hui-hui, LONG Ru, QIN Shu-hua. Clinical observation of sternocleidomastoid muscle flaps combined with artificial biological membrane reparing the defects after parotidectomy[J]. journal1, 2016, 24(1): 29 -32 .
[10] LI Bin, HE Xiao-ning, GAO Yuan, HU Yu-ping. Clinical analysis of pain after two kinds of apical stop preparation[J]. journal1, 2016, 24(1): 40 -43 .
This work is licensed under a Creative Commons Attribution 3.0 License.