Journal of Prevention and Treatment for Stomatological Diseases ›› 2020, Vol. 28 ›› Issue (3): 153-157.doi: 10.12016/j.issn.2096-1456.2020.03.003

• Basic Study • Previous Articles     Next Articles

Knockdown of circ_0001273 inhibits the proliferation, migration and invasion of oral squamous cell carcinoma cells

ZENG Fantao1,YU Dongsheng2()   

  1. 1. Department of Stomatology, the Second Affiliated Hospital of Guangzhou Medical University, Guangzhou 510260, China
    2. Hospital of Stomatology, Guanghua School of Stomatology, Sun Yat-sen University, Guangdong Provincial Key Laboratory of Stomatology, Guangzhou 510055, China
  • Received:2019-09-10 Revised:2019-11-07 Online:2020-03-20 Published:2020-03-20
  • Contact: Dongsheng YU E-mail:yudsh@mail.sysu.edu.cn

Abstract:

Objective To explore the effect of circ_0001273 on the proliferation, migration and invasion of oral squamous cell carcinoma(OSCC) cells and to provide a relevant research basis for the use of targeted therapy in OSCC. Methods Data from twelve patients with a clinical diagnosis of OSCC were collected from tumor specimens and adjacent tissues. qRT-PCR was used to detect the expression levels of circ_0001273, circ_0018569, circ_0027152, and circ_0001273 which had the highest difference in expression in cancer and adjacent tissues was selected. siRNA was used for the knockdown of circ_0001273 in two types of OSCC cell lines, UM1 and CAL27, and the effects on the proliferation, migration, and invasion of UM1 and CAL27 cells were measured by MTS and Transwell experiments, respectively. Results The expression of circ_0001273 was abnormally increased in the 12 OSCC tissues (P < 0.05). After knocking down circ_0001273 in UM1 and CAL27 cells, the proliferation, migration and invasion abilities of UM1 and CAL27 cells were significantly reduced (P < 0.05). Conclusion The knockdown of circ_0001273 can inhibit the proliferation, migration and invasion of OSCC cells.

Key words: oral squamous cell carcinoma cells, squamous cell, carcinoma, circRNA, circ_0001273, OSCC cell lines UM1, OSCC cell lines CAL27, proliferation, migration, invasion

CLC Number: 

  • R78

Table 1

Primer sequences"

circRNA Sequence(5′→3′)
hsa_circ_0001273-F CCACCTCCAATGACAGACTT
hsa_circ_0001273-R CACACCTTAGCTGCTGACAC
hsa_circ_0018569-F TCAAGGACGCACTATCATCT
hsa_circ_0018569-R CCGCTGTAAACATGATGGAA
hsa_circ_0027152-F CTGCGACGGGGACAATGACTG
hsa_circ_0027152-R GGCCCATCGTCCGTCCAGTAC
18srRNA-F CCTGGATACCGCAGCTAGGA
18srRNA-R GCGGCGCAATACGAATGCCCC

Figure 1

Relative expression of circ_0001273, circ_0018569, circ_0027152 in 12 oral squamous cell carcinoma and adjacent tissues ***: P < 0.001. NOR: adjacent tissues; CAN: cancer tissues"

Figure 2

Relative expression of circ_0001273 in 4 groups of oral squamous cell carcinoma cells after knockdown of circ_0001273"

Figure 3

Effect of circ_0001273 siRNA on the proliferation of UM1 and CAL27 cells"

Figure 4

Effect of circ_0001273 siRNA on the migration ability of UM1 and CAL27 cells **: P < 0.01. Magnification: × 100"

Figure 5

Effect of circ_0001273 siRNA on the invasion ability of UM1 and CAL27 cells **: P < 0.01. Magnification: × 100"

[1] Rhodus NL, Kerr AR, Patel K . Oral cancer: leukoplakia, premalignancy, and squamous cell carcinoma[J]. Dent Clin North Am, 2014,58(2):315-340.
[2] Salzman J, Gawad C, Wang PL , et al. Circular RNAs are the predominant transcript isoform from hundreds of human genes in diverse cell types[J]. PLoS One, 2012,7(2):e30733.
[3] Chen L, Zhang S, Wu J , et al. circRNA_100290 plays a role in oral cancer by functioning as a sponge of the miR-29 family[J]. Oncogene, 2017,36(32) : 4551-4561.
[4] Wu Y, Zhang Y, Zhang Y , et al. CircRNA hsa_circ_0005105 upregulates NAMPT expression and promotes chondrocyte extracellular matrix degradation by sponging miR-26a[J]. Cell Biol Int, 2017,41(12):1283-1289.
[5] Cardamone G, Parabschi EM, Rimoldi V , et al. The characterization of GSDMB splicing and back splicing profiles identifies novel isoforms and a circular RNA that are dysregulated in multiple sclerosis[J]. Int J Mol Sci, 2017,18(3):e576.
[6] Burd CE, Jeck WR, Liu Y , et al. Expression of linear and novelcircular forms of an INK4/ARF-associated non-coding RNA correlates with atherosclerosis risk[J]. PLoS Genet, 2010,6(12):e1001233.
[7] Momen-Heravi F, Bala S . Emerging role of non-coding RNA in oral cancer[J]. Cell Signal, 2018,42:134-143.
[8] Zhu M, Xu Y, Chen Y , et al. Circular BANP, an upregulated circular RNA that modulates cell proliferarion in colorectal cancer[J]. Biomed Pharmacother, 2017,88:138-144.
[9] Li C, Li M, Xue Y . Downregulation of circRNA CDR1 as specifically triggered low-dose diosbulbin-B induced gastric cancer cell death by regulating miR-7-5p/REGγ axis[J]. Biomed Pharmacother, 2019,120:109462.
[10] Li B, Li X . Overexpression of hsa_circ_0007534 predicts unfavorable prognosis for osteosarcoma and regulates cell growth and apoptosis by affecting AKT/GSK-3β signaling pathway[J]. Biomed Pharmacother, 2018,107:860-866.
[11] Yao Y, Hua Q, Zhou Y . CircRNA has_circ_0006427 suppresses the progression of lung adenocarcinoma by regulating miR-6783-3p/DKK1 axis and inactivating Wnt/β-catenin signaling pathway[J]. Biochem Biophys Res Commun, 2019,508(1):37-45.
[12] Xie B, Zhao Z, Liu Q , et al. CircRNA has_circ_0078710 acts as the sponge of microRNA-31 involved in hepatocellular carcinoma progression[J]. Gene, 2019,683:253-261.
[13] Cao S, Chen G, Yan L , et al. Contribution of dysregulated circRNA_100876 to proliferation and metastasis of esophageal squamous cell carcinoma[J]. Onco Targets Ther, 2018,11:7385-7394.
[14] Wang S, Li Q, Wang Y , et al. Upregulation of circ-UBAP2 predicts poor prognosis and promotes triple-negative breast cancer progression through the miR-661/MTA1 pathway[J]. Biochem Biophys Res Commun, 2018,505(4):996-1002.
[15] Wang L, Wei Y, Yan Y , et al. CircDOCK1 suppresses cell apoptosis via inhibition of miR-196a-5p by targeting BIRC3 in OSCC[J]. Oncol Rep, 2018,39(3):951-966.
[1] WU Fayin,XU Haili. Effect and mechanism of allicin combined with 5-fluorouracil on proliferation and apoptosis of the MEC-1 cell line in mucoepidermoid carcinoma [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(6): 355-360.
[2] WANG Zhangsong,XIE Shule,ZHANG Hanqing,FANG Zezhen,LI Qunxing,FAN Song,LI Jinsong. Clinical and pathological analysis of 2 456 cases of salivary gland tumor [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(5): 298-302.
[3] ZHANG Haifeng,NAN Xinrong,HUA Yongqing. Research progress on the consistency and evaluation factors of cervical lymphatic metastasis in early tongue cancer [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(5): 336-340.
[4] WU Donghui,ZHU Yunying,LIANG Jianqiang,LIN Zhaoyu,LI Jinsong. Study on lncRNA ADAMTS9-AS2 promoting invasion and metastasis of salivary adenoid cystic carcinoma [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(4): 214-218.
[5] LIAN Keqian,ZHANG Xin,ZHOU Jieyu,LIAO Yanfen,SI Shanshan. Biocompatibility of bone marrow mesenchymal cells on polyetheretherketone and titanium surfaces in vitro [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(2): 73-78.
[6] YUAN Kaifang,CHEN Weiliang,ZHOU Bin,ZHANG Daming. Comparison of the clinical effect of a facial-submental artery island flap in reconstruction after resection of oral cavity and oropharyngeal squamous cell carcinoma [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(2): 84-87.
[7] ZHOU Jiaqi,SHU Linjing,XIONG Yi,ZHANG Yixin,XIANG Lin,WU Yingying. Study on the role of FoxO1 in the regulation of osteoblastic metabolism by 1,25(OH)2D3 in a high glucose environment [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(1): 24-29.
[8] HE Jialin, XU Yan, XIE Xianzhe, WANG Tengfei, HUO Dongmei. Effect of platelet-rich fibrin extract on the proliferation of gingival fibroblasts [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(8): 490-495.
[9] Xinyu LIN,Weixiong CHEN,Xinyuan LEI,Zhanpeng OU,song FAN,Jinsong LI. Screening and identification of mitochondrial miRNAs related to chemotherapy resistance in tongue squamous cell carcinoma [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(7): 417-422.
[10] Zehong GUO,Yingyuan NING,Shulan XU,Peijun ZHU,Xianglong DING,Yan GAO. Effect of laser-etched pure titanium surface on early proliferation of MG63 cells [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(7): 435-440.
[11] Xinyuan LEI,Xinyu LIN,Zhanpeng OU,Yi RUAN,Jinsong LI. Mitochondrial fission protein 1 determines mitochondrial fission and cisplatin sensitivity in tongue squamous cell carcinoma [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(6): 350-354.
[12] XU Shuaimei,ZENG Xiongqun,YUAN Peiyan,LIU Zhongjun,ZENG Shuguang. The role of APOD in the proliferation and migration of human dental pulp cells [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(6): 355-359.
[13] GUI Xinwei,YAO Xiaowu,CHEN Shisheng,LU Zizheng,LIN Minxiao,PENG Yu. Expression of NF-κB in oral squamous cell carcinoma and paracancerous tissues and its significance [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(6): 360-364.
[14] LIN Lin,DUAN Ning,WANG Xiang,JIANG Hongliu,WANG Wenmei. Oral verrucous xanthoma in adolescents: a case report and literature review [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(5): 318-320.
[15] ZHONG Wende,LIU Rongjing,GUAN Hongbing,CHEN Guangsheng. Research on the inhibitory effect of Baicalin on the human tongue squamous cell carcinoma cell line SCC15 [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(4): 226-230.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
[1] Hong-chang LAI,Jun-yu SHI. Maxillary sinus floor elevation[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(1): 8 -12 .
[2] Pin ZHOU, Yang-fei LI. MRI study of temporomandibular joint disc position in asymptomatic volunteers[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(4): 239 -244 .
[3] Xinxin XIA, Fang FANG, Lijuan CHENG. Shaping ability of Pathfile and WaveOne in simulated root canals[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(6): 365 -368 .
[4] Yuanhong LI, Xinyi FANG, Yu QIU, Lei CHENG. Experimental study on the effects of green tea on salivary flow rate and pH value[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(9): 560 -564 .
[5] Chengzhang LI. Masticatory muscles in occlusion[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(12): 755 -760 .
[6] . [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(1): 1 .
[7] Zhirong WU, Shiguang Huang. Research progress on the etiology, clinical examination and treatment of peri-implantitis[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(6): 401 -405 .
[8] Xiaowu YAO, Shisheng CHEN, Zizheng LU, Minxiao LIN. Clinical report and literature review on the amyloidosis of salivary glands[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(8): 533 -536 .
[9] Lan LIAO, Lijun ZENG. Updated research on digitalization in aesthetic restoration[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(7): 409 -414 .
[10] Yu LU, Chengxia LIU, Zhongjun LIU. Role of TRAF6 in inflammatory responses of human osteoblast-like cells with Enterococcusfaecalis[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(7): 420 -425 .
This work is licensed under a Creative Commons Attribution 3.0 License.