Journal of Prevention and Treatment for Stomatological Diseases ›› 2020, Vol. 28 ›› Issue (6): 349-354.doi: 10.12016/j.issn.2096-1456.2020.06.002

• Basic Study • Previous Articles     Next Articles

Signal transducer and activator of transcription 3 positively modulates orthodontic tooth movement speed and alveolar bone mass

ZHANG Cheng,TAO Guiyu,HUANG Li,LV Chunxiao,LI Tiancheng,YIN Xing,ZOU Shujuan()   

  1. State Key Laboratory of Oral Diseases & National Clinical Research Center for Oral Diseases & Department of Orthodontics, West China Hospital of Stomatology, Sichuan University, Chengdu 610041, China
  • Received:2019-10-18 Revised:2020-02-08 Online:2020-06-20 Published:2020-05-28
  • Contact: Shujuan ZOU E-mail:shujuanzou@aliyun.com

Abstract:

Objective To elucidate the role of signal transducer and activator of transcription 3 on orthodontic tooth movement, aiming at providing evidence for improving orthodontic bone modeling and remodeling. Methods Orthodontic tooth movement (OTM) models were established in 8-week-old Wistar rats, which were divided into 2 groups: the control group (tooth movement) and the test group (tooth movement with local injection of STAT3 inhibitor stattic). Rats were sacrificed on day 7 and 14. Micro-CT scanning was conducted to measure bone volume/tissue volume (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), and bone mineral density (BMD), and the amount of tooth movement of the specimens. The mouse preosteoblastic cell line MC3T3-e1 and mononuclear macrophagic leukemia cell line RAW264.7 were cocultured in Transwell® culture plates and divided into the control group (blank) and the test group (STAT3 inhibitor stattic was added). Alkaline phosphatase (ALP) staining and tartrate-resistant acid phosphatase (TRAP) staining were carried out to reveal osteoblastic and osteoclastic differentiation, respectively. qRT-PCR was performed to evaluate mRNA expression levels of the receptor activator of nuclear factor-κB ligand (RANKL) and osteoprotegerin (OPG) in the MC3T3-e1 cells. Results Compared with the control group, in the test group, the alveolar bone at the OTM site showed a significant decrease in the BV/TV, Tb.N, Tb.Th, and BMD indexes and a significant increase in Tb.Sp on day 14, while there was no significant difference in the above indexes between the two groups on day 7. The amount of tooth movement was significantly smaller in the test group on day 7 but showed no difference on day 14. ALP staining and TRAP staining revealed weakened osteoblastic and osteoclastic differentiation in the test group. qRT-PCR demonstrated the inhibitor inhibited the mRNA expression of RANKL and OPG and increased the mRNA ratio of RANKL/OPG in osteogenic precursor cells. Conclusion Suppression of STAT3 activation leads to inhibition of both osteoblastic and osteoclastic differentiation, resulting in lowered tooth movement and catabolic effects on alveolar bone. STAT3 may play an important role in orthodontic bone modeling and bone remodeling.

Key words: rats, tooth movement, osteogenesis, osteoporosis, signal transducer and activator of transcription 3, stattic, osteoclast, osteoblast

CLC Number: 

  • R783.5

Figure 1

Intra-oral picture of the device for orthodontic tooth movement and location of the local injection in rats"

Table 1

Sequences of primers for qRT-PCR"

Genes Primer sequences(5′→3′)
RANKL F: CAGCATCGCTCTGTTCCTGTA
R: CTGCGTTTTCATGGAGTCTCA
OPG F: GAGGAGTCTGGTAGTGGTTCC
R: TGTTCACCCTGGTTGAGTAAGT
GAPDH F: GACATCAAGAAGGTGGTGAAGC
R: GAAGGTGGAAGAGTGGGAGTT

Figure 2

Micro-CT sagittal images of alveolar bone of the upper first molars at the bifurcation on day 7 and day 14 in two groups of rats a: the trabecular morphology of interradicular alveolar bone of the upper first molars in the control group on day 7; b: the trabecular morphology of interradicular alveolar bone of the upper first molars in the test group on day 7; c: the trabecular morphology of interradicular alveolar bone of the upper first molars in the control group on day 14; d: the trabecular morphology of interradicular alveolar bone of the upper first molars in the test group on day 14"

Table 2

Micro-CT measurements of the alveolar bone microstructure of the upper first molars at the bifurcation on day 7 and day 14 in two groups of rats x ± s"

Parameters Days Control group Test group P t
BV/TV(%) 7 0.597 ± 0.032 0.575 ± 0.063 0.490 0.72
14 0.533 ± 0.028 0.455 ± 0.030 0.003 3.81
Tb.N(1/mm) 7 8.290 ± 0.599 7.920 ± 0.443 0.286 1.13
14 7.970 ± 0.591 7.090 ± 0.491 0.028 2.57
Tb.Th(mm) 7 0.095 ± 0.012 0.095 ± 0.010 0.982 0.02
14 0.085 ± 0.006 0.069 ± 0.008 0.006 3.44
Tb.Sp(mm) 7 0.090 ± 0.015 0.098 ± 0.013 0.421 0.84
14 0.092 ± 0.016 0.116 ± 0.012 0.025 2.63
BMD(g/cc) 7 1.100 ± 0.085 1.060 ± 0.080 0.442 0.80
14 1.030 ± 0.075 0.902 ± 0.067 0.016 2.89

Table 3

ANOVA table of micro-CT analysis"

Parameters Source of variation F P
BV/TV(%) Interaction 2.70 0.131
Time 30.20 <0.001
Inhibitor 6.06 0.034
Tb.N(1/mm) Interaction 19.73 0.001
Time 101.90 < 0.001
Inhibitor 3.55 0.089
Tb.Th(mm) Interaction 10.69 0.008
Time 53.60 < 0.001
Inhibitor 2.09 0.179
Tb.Sp(mm) Interaction 23.29 0.001
Time 39.65 < 0.001
Inhibitor 3.09 0.110
BMD(g/cc) Interaction 4.48 0.060
Time 28.15 <0.001
Inhibitor 3.79 0.080

Table 4

Change in the amount of tooth movement with time in the two groups x ± s, mm"

Days Control group Test group Mean t P
7 0.343 ± 0.041 0.273 ± 0.044 0.308 ± 0.055 3.280 0.005
14 0.406 ± 0.038 0.423 ± 0.029 0.414 ± 0.035 1.056 0.307

Figure 3

The osteoblastic differentiation of MC3T3-e1 cells and the osteoclastic differentiation of RAW264.7 cells in the two groups a: ALP staining of MC3T3-e1 cells in the control group (× 40); b: ALP staining of MC3T3-e1 cells in the test group (× 40); c: TRAP staining of RAW264.7 cells in the control group (× 40); d: TRAP staining of RAW264.7 cells in the test group (× 40); ALP: alkaline phosphatase; TRAP: tartrate-resistant acid phosphatase"

Table 5

mRNA expression levels of RANKL and OPG as well as the RANKL/OPG ratio in MC3T3-e1 of the 2 groups x ± s"

Measurements Control group Test group P t
RANKL 1.000 ± 0.093 0.677 ± 0.041 0.011 4.510
OPG 1.030 ± 0.065 0.604 ± 0.077 0.004 5.990
RANKL/OPG ratio 0.971 ± 0.042 1.241 ± 0.089 0.038 3.058
[1] Sims NA . Cell-specific paracrine actions of IL-6 family cytokines from bone, marrow and muscle that control bone formation and resorption[J]. Int J Biochem Cell Biol, 2016,79:14-23.
doi: 10.1016/j.biocel.2016.08.003
[2] Yang Y, Chung MR, Zhou S , et al. STAT3 controls osteoclast differentiation and bone homeostasis by regulating NFATc1 transcription[J]. J Biol Chem, 2019,294(42):15395-15407.
[3] Corry KA, Zhou H, Brustovetsky T , et al. STAT3 in osteocytes mediates osteogenic response to loading[J]. Bone Rep, 2019,11:100218.
[4] Zhou Y, He X, Zhang D . Study of bone remodeling in corticotomy-assisted orthodontic tooth movement in rats[J]. J Cell Biochem, 2019,120(9):15952-15962.
doi: 10.1002/jcb.v120.9
[5] Qamruddin I, Alam MK, Mahroof V , et al. Effects of low-level laser irradiation on the rate of orthodontic tooth movement and associated pain with self-ligating brackets[J]. Am J Orthod Dentofacial Orthop, 2017,152(5):622-630.
[6] Shipley T, Farouk K, El-Bialy T . Effect of high-frequency vibration on orthodontic tooth movement and bone density[J]. J Orthod Sci, 2019,8(1):15.
doi: 10.4103/jos.JOS_17_19
[7] Kirschneck C, Fanghanel J, Wahlmann U , et al. Interactive effects of periodontitis and orthodontic tooth movement on dental root resorption, tooth movement velocity and alveolar bone loss in a rat model[J]. Anat Anz, 2017,210:32-43.
doi: 10.1016/j.aanat.2016.10.004
[8] Liu Y, Song F, Wu S , et al. Protein and mRNA expressions of IL-6 and its key signaling factors under orthodontic forces in mice: an in-vivo study[J]. Am J Orthod Dentofacial Orthop, 2017,152(5):654-662.
[9] Toker H, Görgün EP, Korkmaz EM . Analysis of IL-6, IL-10 and NF-κB gene polymorphisms in aggressive and chronic periodontitis[J]. Cent Eur J Public Health, 2017,25(2):157-162.
[10] Li J . JAK-STAT and bone metabolism[J]. JAK-STAT, 2013,2(3):e23930.
doi: 10.4161/jkst.23930
[11] Liu T, Qin AP, Liao B , et al. A novel microRNA regulates osteoclast differentiation via targeting protein inhibitor of activated STAT3 (PIAS3)[J]. Bone, 2014,67:156-165.
doi: 10.1016/j.bone.2014.07.004
[12] Lim R, Li L, Chew N , et al. The prenylflavonoid icaritin enhances osteoblast proliferation and function by signal transducer and activator of transcription factor 3 (STAT-3) regulation of C-X-C chemokine receptor type 4 (CXCR4) expression[J]. Bone, 2017,105:122-133.
[13] Kurozumi A, Nakano K, Yamagata K , et al. IL-6 and sIL-6R induces STAT3-dependent differentiation of human VSMCs into osteoblast-like cells through JMJD2B-mediated histone demethylation of RUNX2[J]. Bone, 2019,124:53-61.
[14] Nicolaidou V, Wong MM, Redpath AN , et al. Monocytes induce STAT3 activation in human mesenchymal stem cells to promote osteoblast formation[J]. PLoS One, 2012,7(7):e39871.
doi: 10.1371/journal.pone.0039871
[15] Scheuerman O, Hoffer V, Cohen AH , et al. Reduced bone density in patients with autosomal dominant hyper-IgE syndrome[J]. J Clin Immunol, 2013,33(5):903-908.
doi: 10.1007/s10875-013-9895-0
[16] Mori T, Miyamoto T, Yoshida H , et al. IL-1β and TNFα-initiated IL-6-STAT3 pathway is critical in mediating inflammatory cytokines and RANKL expression in inflammatory arthritis[J]. Int Immunol, 2011,23(11):701-712.
doi: 10.1093/intimm/dxr077
[17] Baloul SS . Osteoclastogenesis and osteogenesis during tooth movement[J]. Front Oral Biol, 2016,18:75-79.
[1] WEN Dandan,LV Yalin. Effect of different doses of aspirin on the early osseointegration of titanium alloy implants in rats [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(5): 285-291.
[2] PENG Haiyan,JIANG Xiaowen,HUANG Huaqing,CHEN Jinyong. The role of the mTORC1 signaling pathway during osteogenic differentiation of mouse bone marrow mesenchymal cells under tension stress [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(4): 219-223.
[3] LIAN Keqian,ZHANG Xin,ZHOU Jieyu,LIAO Yanfen,SI Shanshan. Biocompatibility of bone marrow mesenchymal cells on polyetheretherketone and titanium surfaces in vitro [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(2): 73-78.
[4] ZHOU Jiaqi,SHU Linjing,XIONG Yi,ZHANG Yixin,XIANG Lin,WU Yingying. Study on the role of FoxO1 in the regulation of osteoblastic metabolism by 1,25(OH)2D3 in a high glucose environment [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(1): 24-29.
[5] JIANG Xiaowen,HUANG Huaqing,CHEN Jinyong,PENG Haiyan. Experimental study of periostin promoting rapid distraction osteogenesis of the rabbit mandible [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(9): 551-556.
[6] ZHAO Qiucheng,LIU Hanghang,HE Ze,ZHOU Yingxin,LUO En. Simultaneous distraction osteogenesis of the maxilla and mandible combined with second-stage orthognathic surgery for correction of hemifacial microsomia in adults [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(9): 569-576.
[7] Bo YANG,Mengfan FU,Zhangui TANG. Effect of arecoline on SD rat survival after buccal mucosal biopsy [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(7): 423-427.
[8] ZHU Yanxia,Gegen tana. Research progress of IL-33/ST2 signaling pathway in bone metabolism [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(3): 202-204.
[9] LI Yunfeng,ZHU Songsong. Application of digital technology in diagnosis and treatment of dentofacial deformities [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(2): 74-82.
[10] WANG Ye,LIN Xiaoping. Research progress on the common risk factors and related mechanisms of periodontitis and osteoporosis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(12): 794-798.
[11] MA Yao,JIANG Zhaowei,JIN Yunyi,MIAO Qian,ZHANG Chunxiang,ZHANG Linkun. Gene ontology analysis of the TNF signaling pathway in early orthodontic tooth movement of rats with periodontitis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(11): 695-702.
[12] LU Weiying,LIU Ping,CHEN Jiawei,LIU Shuying,XU Pingping. Effects of X-ray irradiation on proliferation and RANTES expression of the mouse osteogenic precursor cell line MC3T3-E1 [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(10): 621-626.
[13] PAN Xumeng,LIU Yi. The role of myofibroblasts in orthodontic tooth movement [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(10): 667-672.
[14] Xueqian LI,Qiao ZHANG,Xiaoxin ZHANG,Yufeng ZHANG. Osteogenic potential of recombinant human bone morphogenetic protein-2 combined with Bio-oss bone substitute in implant restorations in anterior esthetic region [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(9): 584-591.
[15] Jing ZHANG, Shuangxi ZHU, Wei PENG, Xiang LI, Qiong RONG, Songling CHEN. Culture and identification of the osteogenic properties of beagle maxillary sinus membrane stem cells [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(7): 422-427.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
[1] WU Hongyu,MA Xiaoxin,LU Haixia,FENG Xiping,GU Qin,YE Wei,XIE Yingxin,XIE Danshu,WANG Wenji. Investigation of dental caries and periodontal conditions in maintenance hemodialysis patients[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(5): 313 -317 .
[2] ZHOU Tao,WU Peiyao,YANG Yuqing,CAO Zhiwei,XIE Liang. Research progress on the distribution of primary cilia and related signaling pathways involved in odontogenesis[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(5): 318 -321 .
[3] ZOU Xiaolong,CHEN Yuan,WANG Yan,WANG Jiantao. Research progress on animal models of oral mucositis caused by radiotherapy and chemotherapy[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(5): 322 -326 .
[4] WANG Mengxi,ZHANG Bo,LI Yong,ZHANG Xinduo,GE Lifei,CHANG Zhiqiang. The harm and protective measures of facial occupational exposure of dental medical and nursing personnel[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(5): 327 -330 .
[5] ZHANG Sui,HE Dongning. Current status of immediate implant placement in the aesthetic zone of the anterior teeth[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(5): 331 -335 .
[6] ZHANG Haifeng,NAN Xinrong,HUA Yongqing. Research progress on the consistency and evaluation factors of cervical lymphatic metastasis in early tongue cancer[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(5): 336 -340 .
[7] YE Qingsong, HU Fengting, LUO Lihua, Maria Troulis. Research and application of stem cell-derived exosomes in regenerative medicine[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(1): 1 -10 .
[8] . [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(2): 68 .
[9] TAO Qian,HE Yue,LIU Bing,HOU Jinsong,NAN Xinrong,ZHANG Bin,ZHANG Leitao,QIAO Bin. Expert consensus on marsupialization of cystic lesions of the jaw[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(2): 69 -72 .
[10] LIU Chuanxia,FU Ji,HAO Yilong,HE Hong,CHEN Qianming. Management strategy of oral mucosal diseases during the epidemic of Corona Virus Disease 2019[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(3): 178 -183 .
This work is licensed under a Creative Commons Attribution 3.0 License.