Journal of Prevention and Treatment for Stomatological Diseases ›› 2021, Vol. 29 ›› Issue (4): 226-233.doi: 10.12016/j.issn.2096-1456.2021.04.002

• Basic Study • Previous Articles     Next Articles

A novel biomimetic micro/nano hierarchical interface of titanium enhances adhesion, proliferation and osteogenic differentiation of bone marrow mesenchymal cells

WANG Min(),JIANG Nan,ZHU Songsong()   

  1. State Key Laboratory Oral Diseases, National Clinical Reasearch Center for oral Diseases, Department of oral and Maxillofacial Surgery, West China Hospital of Stomatology, Sichuan University, Chengdu 610041, China
  • Received:2020-08-24 Revised:2020-10-19 Online:2021-04-20 Published:2021-02-26
  • Contact: Songsong ZHU E-mail:15882167039@163.com;zss_1977@163.com
  • Supported by:
    National Natural Science Foundation of China(81901026)

RichHTML

PDF (PC)

Abstract:

Objective To design a novel biomimetic micro/nano hierarchical interface on endosseous titanium implants and investigate its effect on the biological activity of bone marrow mesenchymal cells. Methods Electrochemical anodization and spark plasma sintering were used to modify smooth titanium (untreated Ti group) with a microporous trabecular bone-like architecture (micro-Ti group) and TiO2 nanotube architecture (nano-TiO2 group). Additionally, electrochemical anodization was employed to prepare TiO2 nanotubes on microporous trabecular bone-like architectures, which formed a novel biomimetic hierarchical interface (micro/nano-TiO2 group). Four groups of titanium samples were characterized by field emission scanning electron microscopy (SEM), atomic force microscopy (AFM) and contact angle (CA). Bone marrow mesenchymal cells (BMMCs) were seeded on four groups of titanium samples. Scanning electron microscopy (SEM) was employed to observe cell morphology. Cell proliferation was determined by MTT assay. The expression of focal adhesion proteins (F-actin; vinculin; osteocalcin, OCN; osteopontin, OPN) were observed under a confocal laser scanning microscope (CLSM). The mRNA expression levels of osteogenic factors (runt-related transcription factor 2, RUNX2; osteocalcin, OCN; osteopontin, OPN; collagen I, COL I) were assessed by qRT-PCR. Results The micro/nano- TiO2 group featured a hydrophilic surface (CA=9° ± 2.1°). The results of the MTT assay indicated that the relative cell proliferation rates for the nano- TiO2 and micro/nano-TiO2 samples were significantly increased compared with those for the untreated-Ti and micro-Ti samples (P＜0.001) after 5-9 days. The ALP results indicated that the micro/nano-TiO2 sample gained the highest value at 14 days. After 72 h of incubation, the expression of osteocalcin (OCN) and osteopontin (OPN) on micro/nano-TiO2 was the strongest. After 24 h incubation, the expression of F-actin on micro/nano-TiO2 was the strongest. In comparison with untreated-Ti and micro-Ti samples,the mRNA expression levels of all the osteogenic factors (runt-related transcription factor 2, RUNX2; osteocalcin, OCN; osteopontin, OPN; Collagen I, COL I) were markedly increased on the nano-TiO2 and micro/nano-TiO2 samples, the mRNA expression levels of collagen I (COL I) were significantly different between the nano-TiO2 and micro/nano-TiO2 samples versus the untreated-Ti and micro-Ti samples (P＜0.001). Conclusion The novel biomimetic micro/nano hierarchical interface has a positive effect on cell attachment, viability and osteogenic differentiation of bone marrow mesenchymal cells.

Key words: micro/nano structure, TiO2 nano-tubes, bionic, surface treatment, implants, bone marrow mesenchymal cells, cell adhesion, cell proliferation, osteogenic differentiation, spark plasma sintering, electrochemical anodization

CLC Number: 

  • R78

Table 1

Specific prime sequences of PCR"

Gene Forward primer 5′-3′ Reverse primer 5′-3′
COL I GCTGGCAAGAATGGCGAC AGCCACGATGACCCTTTATG
OCN GGAGGGCAGTAAGGTGGTGA ACGGTGGTGCCATAGATGC
OPN AACAGTATCCCGATGCCACA TGGCTGGTCTTCCCGTTG
RUNX2 CAGGCGTATTTCAGATGATGACA TAAGTGAAGGTGGCTGGATAGTG
Actin CCCATCTATGAGGGTTACGC TTTAATGTCACGCACGATTTC

Figure 1

SEM images of the surface of titanium samples a: untreated-Ti (× 1 000); b: microporous trabecular bone-like architecture (×1 000). It resembled a trabecular bone; c: TiO2 nano-pores arranged uniformly (× 80 000); d: TiO2 nano-pores arranged uniformly (× 160 000); SEM: scanning electronmicroscopy"

Figure 2

AFM images of samples in the untreated-Ti group and nano-TiO2 group a: untreated-Ti group, which showed a relatively rough surface; b: nano-TiO2 group; nano-pores (diameter: 50-120 nm) were observed on its surface; AFM: atomic force microscopy"

Table 2

Surface parameters of samples in the untreated-Ti group and nano-TiO2 group"

Group Surface roughness
（nm）		 Vertical range
（nm）		 Surface difference
（%）
Untreated-Ti
Nano-TiO2		 15.89 ± 2.5
46.30 ± 2.181)		 156.53 ± 30.31
340 ± 33.561)		 7.35 ± 2.18
13.78 ± 2.581)

Figure 3

The static contact angles on the samples in the four groups a: untreated-Ti group, 35° ± 2.3°; b: micro-Ti group, 18° ± 1.6°; c: nano-TiO2 group, 14° ± 1.6°; d: micro/nano-TiO2 group, 9° ± 2.1°"

Figure 4

SEM images of BMMCs 4 h after culture on the surfaces of samples in the four groups a: untreated-Ti group, most of the cells were fusiform, some of which can be seen with pseudopodia and antennas; b: micro-Ti group, the cells were flat and polygonal, with pseudopodia and antennas clearly visible; c: nano-TiO2 group, the cells were flat and polygonal, closely attached to the surface of the titanium samples; d: micro/nano-TiO2 group, cells were connected with each other and grew together flakily, with large numbers of pseudopodia and antennas; SEM: scanning electronmicroscopy"

Figure 5

The cell proliferation rate of BMMCs cultured on the samples in the four groups *: vs. untreated-Ti group, P＜0.05; $: vs. micro-Ti group, P＜0.05. The relative cell proliferation rates of samples in the four groups increased between days 1-9, and the relative cell proliferation rates of samples in the nano-TiO2 group and the micro/nano-TiO2 group significantly increased compared with those in the untreated-Ti group and the micro-Ti group(P＜0.001) between days 5-9"

Figure 6

ALP activity of BMMCs cultured on the samples in the four groups *: vs. untreated-Ti group, P＜0.05; $: vs. micro-Ti group, P＜0.05; #: vs. nano-TiO2 group, P＜0.05. The relative cell proliferation rates of samples in the four groups increased between days 7-14, and the samples in the micro/nano-TiO2 group gained the highest value on the 14th day"

Figure 7

Immunofluorescence staining images of BMMCs cultured on the samples in the four groups （× 400） a: the expression of F-actin and vinculin after 24 h incubation. The expression of F-actin in the micro/nano-TiO2 group was the strongest. b: the expression of OCN and OPN after 72 h incubation. The expression of OCN and OPN in the micro/nano-TiO2 group was the strongest. Blue: cell nucleus; green: either F-actin or OPN; red: either vinculinor or OCN; OCN: osteocalcin; OPN: osteopontin"

Figure 8

mRNA expression levels of various osteogenic transcription factors in the four groups a: RUNX2; b: OCN; c: OPN; d: COL Ⅰ (collagen I). *P＜0.05 vs. untreated-Ti group, #: P＜0.05 vs. micro-Ti group, $: P＜0.05 vs. Nano-TiO2 group. Compared with the untreated-Ti group and the micro-Ti group, the mRNA expression levels of all the osteogenic factors in the nano-TiO2 and micro/nano-TiO2 groups markedly increased; compared with the untreated-Ti group and micro-Ti group, the mRNA expression levels of COL I in the nano-TiO2 and micro/nano-TiO2 groups significantly increased (P < 0.001)"

[1] Jaggessar A, Shahali H, Mathew A, et al. Bio-mimicking nano and micro-structured surface fabrication for antibacterial properties in medical implants[J]. J Nanobiotechnology, 2017,15(1):64. doi: 10.1186/s12951-017-0306-1.
doi: 10.1186/s12951-017-0306-1 pmid: 28969628
[2] Li T, Gulati K, Wang N, et al. Understanding and augmenting the stability of therapeutic nanotubes on anodized titanium implants[J]. Mater Sci Eng C Mater Biol Appl, 2018,88:182-195. doi: 10.1016/j.msec.2018.03.007.
doi: 10.1016/j.msec.2018.03.007 pmid: 29636134
[3] Ahn TK, Lee DH, Kim TS, et al. Modification of titanium implant and titanium dioxide for bone tissue engineering[J]. Adv Exp Med Biol, 2018,1077:355-368. doi: 10.1007/978-981-13-0947-219.
doi: 10.1007/978-981-13-0947-2_19 pmid: 30357698
[4] Zhao C, Wang X, Gao L, et al. The role of the micro-pattern and nano-topography of hydroxyapatite bioceramics on stimulating osteogenic differentiation of mesenchymal stem cells[J]. Acta Biomater, 2018,73:509-521. doi: 10.1016/j.actbio.2018.04.030.
doi: 10.1016/j.actbio.2018.04.030 pmid: 29678674
[5] Zhukova Y, Hiepen C, Knaus P, et al. The Role of titanium surface nanostructuring on preosteoblast morphology, adhesion, and migration[J]. Adv Healthc Mater, 2017,6(15):201601244. doi: 10.1002/adhm.201601244.
[6] Llopis-Grimalt MA, Amengual-Tugores AM, Monjo M, et al. Oriented cell alignment induced by a nanostructured titanium surface enhances expression of cell differentiation markers[J]. Nanomaterials, 2019,9(12):1661. doi: 10.3390/nano9121661.
doi: 10.3390/nano9121661
[7] Duvvuru MK, Han W, Chowdhury PR, et al. Bone marrow stromal cells interaction with titanium:effects of composition and surface modification[J]. PLoS One, 2019,14(5):e0216087. doi: 10.1371/journal.pone.0216087.
doi: 10.1371/journal.pone.0216087 pmid: 31116747
[8] Yuan Z, Liu P, Hao Y, et al. Construction of Ag-incorporated coating on Ti substrates for inhibited bacterial growth and enhanced osteoblast response[J]. Colloids Surf B Biointerfaces, 2018,171:597-605. doi: 10.1016/j.colsurfb.2018.07.064.
doi: 10.1016/j.colsurfb.2018.07.064 pmid: 30099296
[9] Li W, Yang Y, Zhang H, et al. Improvements on biological and antimicrobial properties of titanium modified by AgNPs-loaded chitosan-heparin polyelectrolyte multilayers[J]. J Mater Sci Mater Med, 2019,30(5):52. doi: 10.1007/s10856-019-6250-x.
doi: 10.1007/s10856-019-6250-x pmid: 31016469
[10] Zhong X, Song Y, Yang P, et al. Titanium surface priming with phase-transited lysozyme to establish a silver nanoparticle-loaded chitosan/hyaluronic acid antibacterial multilayer via layer-by-layer self-assembly[J]. PLoS One, 2016,11(1):e0146957. doi: 10.1371/journal.pone.0146957.
doi: 10.1371/journal.pone.0146957 pmid: 26783746
[11] Jang I, Choi DS, Lee JK, et al. Effect of drug-loaded TiO2 nanotube arrays on osseointegration in an orthodontic miniscrew: an in-vivo pilot study[J]. Biomed Microdevices, 2017,19(4):94. doi: 10.1007/s10544-017-0237-5.
pmid: 29071421
[12] Zhao H, Chang CC, Liu Y, et al. Reproducibility and radiation effect of high-resolution in vivo micro computed tomography imaging of the mouse lumbar vertebra and long bone[J]. Ann Biomed Eng, 2020,48(1):157-168. doi: 10.1007/s10439-019-02323-z.
doi: 10.1007/s10439-019-02323-z pmid: 31359266
[13] 许嘉允, 邓飞龙, 庄秀妹, 等. 纯钛微纳米复合形貌对成骨细胞生物学行为的影响[J]. 中华口腔医学研究杂志, 2015,9(6):461-469. doi: 10.3877/cma.j.issn.1674-1366.2015.06.005.
Xu JY, Deng FL, Zhuang XM, et al. The influence of different hybrid micro/nano hierarchical titanium topographies on osteoblast biological functions[J]. Chin J Stomatol, 2015,9(6):461-469. doi: 10.3877/cma.j.issn.1674-1366.2015.06.005.
[14] 罗翠芬, 彭国光, 冯远华, 等. 激素对种植体骨结合影响的研究进展[J]. 口腔疾病防治, 2017,25(7):473-476. doi: 10.12016/j.issn.2096-1456.2017.07.015.
Luo CF, Peng GG, Feng YH, et al. Influence of hormones on osseointegration in dental implant[J]. J Prev Treat Stomotol Dis, 2017,25(7):473-476. doi: 10.12016/j.issn.2096-1456.2017.07.015.
[15] Jang TS, Jung HD, Kim S, et al. Multiscale porous titanium surfaces via a two-step etching process for improved mechanical and biological performance[J]. Biomed Mater, 2017,12(2):025008. doi: 10.1088/1748-605X/aa5d74.
doi: 10.1088/1748-605X/aa5d74 pmid: 28296644
[16] Zahran R, Leal JIR, Valverde MAR, et al. Effect of hydrofluoric acid etching time on titanium topography, chemistry, wettability, and cell adhesion[J]. PLoS One, 2016,11(11):e0165296. doi: 10.1371/journal.pone.0165296.
pmid: 27824875
[17] Ma XJ, Li M, Meng F, et al. Efficient nano titanium electrode via a two-step electrochemical anodization with reconstructed nanotubes: electrochemical activity and stability[J]. Chemosphere, 2018,202:177-183. doi: 10.1016/j.chemosphere.2018.03.063.
doi: 10.1016/j.chemosphere.2018.03.063 pmid: 29571137
[18] Xu D, Wan Y, Li Z, et al. Tailorable hierarchical structures of biomimetic hydroxyapatite micro/nano particles promoting endocytosis and osteogenic differentiation of stem cells[J]. Biomaterials, 2020,8(12):3286-3300. doi: 10.1039/d0bm00443j.
[19] Pan X, Li Y, Abdullah AO, et al. Micro/nano-hierarchical structured TiO(2) coating on titanium by micro-arc oxidation enhances osteoblast adhesion and differentiation[J]. R Soc open Sci, 2019,6(4):182031. doi: 10.1098/rsos.182031.
doi: 10.1098/rsos.182031 pmid: 31183132
[1] CHEN Jing,CHEN Wenchuan. Research progress on tetrabutylammonium dihydrogen trifluoride as a substitute for hydrofluoric acid used for porcelain surface treatment [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(9): 629-633.
[2] CHEN Zetao,LIN Yixiong,YANG Jieting,HUANG Baoxin,CHEN Zhuofan. Research and development concept of barrier membranes based on “ immune microenvironment regulation” [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(8): 505-514.
[3] ZUO Xinhui,LI Jun,HAN Xiangzhen,LIU Xiaoyuan,HE Huiyu. Effects of hypoxia inducible factor-1α on osteogenic differentiation and angiogenesis related factors of bone marrow mesenchymal stem cells [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(7): 449-455.
[4] ZHANG Ying,HU Dandan,HUANG Haoning,LUO Xiaoping. Effect of different treatments of highly translucent zirconia on the bonding strength between zirconia and veneering porcelain [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(7): 456-461.
[5] ZHOU Anqi,LIU Jiayi,JIA Yinan,XIANG Lin. Research progress on the Hippo-YAP signaling pathway mediated osteoimmunology in modulating implant osseointegration [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(5): 334-339.
[6] CUI Linna,JIANG Xiaowen,HUANG Huaqing,CHEN Jinyong. Kaempferol promotes osteogenic differentiation of mouse bone marrow mesenchymal cells under tension stress via the mTORC1 signaling pathway [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(4): 234-240.
[7] LI Tianle,CHANG Xinnan,QIU Xutong,FU Di,ZHANG Tao. Effect of mechanical stimulation on the differentiation of stem cells in periodontal bone tissue engineering [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(4): 273-278.
[8] WANG Chenwei,SUN Fangfang,YANG Chuncheng,DING Ling,CHEN Xi,ZHANG Jiaqi,WU Guofeng. Effects of concentrated sulfuric acid etching durations on the shear bond strength between polyether-ketone-ketone and dentin [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(3): 151-156.
[9] CHEN Zece,LONG Qian,GUAN Xiaoyan,LIU Jianguo. Research progress on microRNA-21 in regulating osteoclast and osteogenic differentiation in orthodontic treatment [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(3): 211-216.
[10] CHEN Shuang,XUE Xin,JIN Xing′ai,LIU Yingqun. Effect of dentin surface treatments on the bond strength of resin-modified glass ionomer cement [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(2): 130-134.
[11] SHI Weiwei,DING Yi,TIAN Weidong,GUO Shujuan. Exosomes derived from lipopolysaccharide-preconditioned dental folic cells regulate osteogenic differentiation of periodontal ligament cell in periodontitis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(2): 81-87.
[12] YAN Shanyu,MEI Hongxiang,LI Juan. Role of mesenchymal stem cells migration in bone injury repair [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(12): 854-858.
[13] WANG Tianqi,DU Qing,XIE Weili. Preparation and antibacterial properties of a copper-niobium coating on a titanium surface by a microarc oxidation-microwave hydrothermal method [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(11): 733-739.
[14] WANG Yanlin,SUN Xiaojun. A study of the maxillary sinus lateral wall thickness using cone-beam CT [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(11): 761-765.
[15] SUN Jingxuan,LI Yanping,PAN Shuang,HE Lina,SUN Xiangyu,ZHANG Shuang,NIU Yumei. Effects of graphene on the proliferation, migration and morphology of dental pulp stem cells [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(10): 656-662.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] ZHU Song-song, HU Jing. The application of distraction osteogenesis in the temporomandibular joint ankylosis and secondary dentofacial deformities[J]. journal1, 2016, 24(1): 6 -10 .
[2] XU Jing. The influence of the impacted mandibular third molar extraction on the distal periodontal tissue of the mandibular second molar[J]. journal1, 2016, 24(1): 11 -14 .
[3] ZHONG Jiang-long, PAN Ji-yang, CHEN Wei-liang. The evaluation of Eagle syndrome treatment by surgery combined with antidepressant therapy[J]. journal1, 2016, 24(1): 26 -28 .
[4] CHEN Xi, SUN Qin-zhou. The study of colorimetric board of porcelain fused to metal restoration for moderate to severe dental fluorosis[J]. journal1, 2016, 24(1): 33 -36 .
[5] OUYANG Ke-xiong1, LIANG Jun, ZOU Rui, LI Zhi-qiang, BAI Zhi-bao, PIAO Zheng-guo, ZHAO Jian-Jiang.. Ion Torrent RNA-Seq detection and analysis of the long non-coding RNA in tongue squamous cell carcinoma[J]. journal1, 2016, 24(1): 15 -19 .
[6] YU Pei, XUE Jing, ZHANG Xiao-wei, ZHENG Cang-shang. The influence of the roughness of zirconia ceramic surface on microbial attachment[J]. journal1, 2016, 24(1): 20 -25 .
[7] LIU Fang. Clinical assessment of two fissure sealant techniques in children’s dental caries prevention[J]. journal1, 2016, 24(1): 44 -45 .
[8] . [J]. journal1, 2016, 24(1): 49 -52 .
[9] LU Jian-rong, BAN Hua-jie, WANG Dai-you, ZHOU Hui-hui, LONG Ru, QIN Shu-hua. Clinical observation of sternocleidomastoid muscle flaps combined with artificial biological membrane reparing the defects after parotidectomy[J]. journal1, 2016, 24(1): 29 -32 .
[10] LI Bin, HE Xiao-ning, GAO Yuan, HU Yu-ping. Clinical analysis of pain after two kinds of apical stop preparation[J]. journal1, 2016, 24(1): 40 -43 .

Copyright © Editorial Board of Journal of Prevention and Treatment for Stomatological Diseases

This work is licensed under a Creative Commons Attribution 3.0 License.

Address:Guangzhou City Jiangnan Road South 366, Editorial office ofJournal of Prevention and Treatment for Stomatological Diseases, zip code: 510280　Fax:020-34304115
E-mail：kqjbfz@vip.126.com

Supported by:Beijing Magtech

This work is licensed under a Creative Commons Attribution 3.0 License.