Journal of Prevention and Treatment for Stomatological Diseases ›› 2021, Vol. 29 ›› Issue (4): 234-240.doi: 10.12016/j.issn.2096-1456.2021.04.003

• Basic Study • Previous Articles     Next Articles

Kaempferol promotes osteogenic differentiation of mouse bone marrow mesenchymal cells under tension stress via the mTORC1 signaling pathway

CUI Linna1,2(),JIANG Xiaowen1,2(),HUANG Huaqing1,2,CHEN Jinyong1,2   

  1. 1. Department of Stomatology, The First People′s Hospital of Chenzhou City, Institute of Translation Medicine, University of China South, Chenzhou 423000, China
    2. School of Stomatology of Southern Medical University, Guangzhou 510515, China
  • Received:2020-07-21 Revised:2020-08-31 Online:2021-04-20 Published:2021-02-26
  • Contact: Xiaowen JIANG E-mail:490460953@qq.com;jxw0927@163.com
  • Supported by:
    National Natural Science Foundation of China(81301651);Natural Science Foundation of Hunan Province(2018JJ2015);Key Project of the First People′s Hospital of Chenzhou City(N2019-003)

Abstract:

Objective To investigate the activation of the mammalian target of rapamycin complex 1 (mTORC1) signaling pathway molecules during the process by which kaempferol (Kae) promotes osteogenic differentiation of mouse bone marrow mesenchymal cells (BMMCs) under cyclic and uniaxial tension. Methods BMMCs isolated and cultured in vitro were subjected to uniaxial dynamic tension with a 10% shape variable. The appropriate concentration of Kae was selected by cytotoxicity testing. The endogenous mTOR signal was inhibited by pp242. Four hours after traction, alkaline phosphatase (ALP) and osteocalcin (OCN) were detected by chemical colorimetry and ELISA, and the relative concentration of intracellular calcium was detected by flow cytometry. Phosphorylation of mTOR, 4E/BP1, and ribosomal protein S6 kinases (S6K), which are the main molecules of the endogenous mTORC1 signaling pathway, and expression of osteogenic transcription factors (Runx2 and Osterix) were detected by western blotting (WB), and mRNA expression levels of the above factors were detected by qRT-PCR. Results The cytotoxicity test showed that 10 μmol/L Kae had little inhibitory effect on cell proliferation but had the strongest osteogenic ability. Four hours after stretching, Kae effectively promoted the osteogenic differentiation of BMMCs. The expression of ALP was (153.04 ± 18.72) U/mg, the expression of OCN was (1.64 ± 0.25) U. The mRNA and protein levels of Runx2 and Osterix were upregulated, and the intracellular calcium content was decreased. The mRNA and protein phosphorylation of mTOR and S6K was upregulated, and the opposite effect was observed with 4E/BP1. After pp242 was added to inhibit mTOR signaling, mTOR and S6K mRNA and protein phosphorylation were downregulated, but 4E/BP1 mRNA and protein phosphorylation was upregulated. The osteogenic differentiation of BMMCs was also significantly inhibited, mRNA and protein expression of Runx2 and Osterix were significantly downregulated, ALP and OCN expression were downregulated, and intracellular calcium content was increased. Conclusion Kae promotes osteogenic differentiation of mouse BMMCs under uniaxial dynamic tension through the mTORC1 signaling pathway.

Key words: bone marrow mesenchymal cells, mammalian target of rapamycin complex 1, cyclic uniaxial tension, distraction osteogenesis, alkaline phosphatase, osteocalcin, runt related transcription factors, ribosomal protein S6 kinase, kaempferol

CLC Number: 

  • R78

Figure 1

Schematic diagram of BMMCs before and after stretching BMMCs: bone marrow mesenchymal cells"

Table 1

Sequences of primers for qRT-PCR"

Gene Primer sequences
GAPDH F: AGTGCCAGCCTCGTCTCATAG
R: CGTTGAACTTGCCGTGGGTAG
Runx2 F:TGGCATCATCTTCATTGTCC
R: CAGAGCATTGTCCTCCCACT
Osterix F:GCCAGAGTGGTTATCTTTTGATG
R: AGTGTGTTATCCCTGCTGTCAC
mTOR F:TTGGAGAACCAGCCCATAAGA
R: ATGAGATGTCGCTTGCTTGATAA
4E/BP1 F:ATAATGCTGGGGAGGATGC
R: TAGGGTGTCGCTGTGGAAAT
S6K F:ACTCATTCCAGACCCACGAC
R: ACACAATCTCCGCACCGTA

Figure 2

Inhibition of cell proliferation and cell counting 4 h after stretching under various concentrations of Kae a: inhibition rates of cell proliferation 4 hours after stretching. The difference between groups was statistically significant, except for the 5 μmol/L vs. 10 μmol/L (P=0.073); b: cells counting, 1 h: 1 μmol/L vs. 5 μmol/L, 5 μmol/L vs. 10 μmol/L, 5 μmol/L vs. 50 μmol/L,10 μmol/L vs. 50 μmol/L, P > 0.05; 4 h: 1 μmol/L vs. 5 μmol/L; 1 μmol/L vs. 10 μmol/L, 5 μmol/L vs. 10 μmol/L, P > 0.05; 8 h: 1 μmol/L vs. 5 μmol/L; 5 μmol/Lvs. 10 μmol/L, P > 0.05; cell proliferation was significantly inhibited in group 50 μmol/L and 100 μmol/L"

Figure 3

Alizarin staining images 7 days after stretching under various concentrations of Kae a: 1 μmol/L; b: 5 μmol/L; c: 10 μmol/L; d: 50 μmol/L; e: 100 μmol/L"

Figure 4

Levels of ALP, OCN and relative concentration of intracellular calcium in four groups 4 hours after application of dynamic tensile force a: ALP, there was significant difference between groups (P<0.05) except group A vs. group D, *: P=0.359; b: OCN, there was significant difference between groups (P<0.05); c: relative concentration of intracellular calcium, there was significant difference between groups (P<0.05) except group A vs. group B, group B vs. group D, *: P=0.350, **: P=0.189; group A: control group; group B: pp242 group; group C: Kae group; group D: Kae+pp242 group; OCN: osteocalcin; ALP: alkaline phosphatase"

Figure 5

The mRNA levels of the major signaling molecules of the mTORC1 signaling pathway and osteogenic transcription factors in BMMCs 4 hours after appplication of dynamic tensile force a-e: mRNA levels of mTOR(a), S6K(b), 4E/BP1(c), Runx2(d), and Osterix(e), group A: control group; group B: pp242 group; group c: Kae group; group D: Kae +pp242group; *: P > 0.05; f: protein levels of p-mTOR, p-S6K, p-4E/BP1, p-mTOR, Osterix, Runx2; mTOR: mammalian target of rapamycin; S6K: ribosomal protein S6 kinases"

[1] Hvid I, Horn J, Huhnstock S, et al. The biology of bone lengthening[J]. J Child Orthop, 2016,10(6):487-492. doi: 10.1007/s11832-016-0780-2.
doi: 10.1007/s11832-016-0780-2 pmid: 27838825
[2] Zhang RS, Lin LO, Hoppe IC, et al. Risk factors for perioperative respiratory failure following mandibular distraction osteogenesis for micrognathia: a retrospective cohort study[J]. Plast Reconstr Surg, 2019,143(6):1725-1736. doi: 10.1097/PRS.0000000000 005651.
pmid: 31136491
[3] 彭海艳, 蒋校文, 黄华庆, 等. mTORC1信号通路在张应力下小鼠骨髓间充质细胞成骨分化过程中的作用[J]. 口腔疾病防治, 2020,28(4):219-223. doi: 10.12016/j.issn.2096-1456.2020.04.003.
Peng HY, Jiang XW, Huang HQ, et al. The role of the mTORC1 signaling pathway during osteogenic differentiation of mouse bone marrow mesenchymal cells under tension stress[J]. J Prev Treat Stomatol Dis, 2020,28(4):219-223. doi: 10.12016/j.issn.2096-1456.2020.04.003.
[4] Guo AJ, Choi RC, Zheng KY, et al. Kaempferol as a flavonoid induces osteoblastic differentiation via estrogen receptor signaling[J]. Chin Med, 2012,7(1):10. doi: 10.1186/1749-8546-7-10.
[5] Yang L, Takai H, Utsunomiya T, et al. Kaempferol stimulates bone sialoprotein gene transcription and new bone formation[J]. J Cell Biochem, 2010,110(6) : 1342-1355. doi: 10.1002/jcb.22649.
doi: 10.1002/jcb.22649 pmid: 20564228
[6] Miyake M, Arai N, Ushio S, et al. Promoting effect of kaempferol on the differentiation and mineralization of murine pre-osteoblastic cell line MC3 T3-E1[J]. Biosci Biotechnol Biochem, 2003,67(6):1199-1205. doi: 10.1271/bbb.67.1199.
doi: 10.1271/bbb.67.1199 pmid: 12843643
[7] Prouillet C, Mazière JC, Mazière C, et al. Stimulatory effect of naturally occurring flavonols quercetin and kaempferolon alkaline phosphatase activity in MG-63 human osteoblasts through ERK and estrogen receptor pathway[J]. Biochem Pharmacol, 2004,67(7):1307-1313. doi: 10.1016/j.bcp.2003.11.009.
doi: 10.1016/j.bcp.2003.11.009 pmid: 15013846
[8] Kumar A, Gupta GK, Khedgikar V, et al. In vivo efficacy studies of layer-by-layernano-matrix bearing kaempferol for the conditions of osteoporosis: a study in ovariectomized rat model[J]. Eur J Pharm Biopharm, 2012,82(3):508-517. doi: 10.1016/j.ejpb.2012. 08.001.
pmid: 22926146
[9] Trivedi R, Kumar S, Kumar A, et al. Kaempferol has osteogenic effect in ovariectomized adult Sprague-Dawley rats[J]. Mol Cell Endocrinol, 2008,289(1/2):85-93. doi: 10.1016/j.mce.2008.02.027.
doi: 10.1016/j.mce.2008.02.027
[10] Ben-Sahra I, Manning BD. mTORC1 signaling and the metabolic control of cell growth[J]. Curr Opin Cell Biol, 2017,45:72-82. doi: 10.1016/j.ceb.2017.02.012.
doi: 10.1016/j.ceb.2017.02.012 pmid: 28411448
[11] Kumar V, Evans LC, Kurth T, et al. Therapeutic suppression of mTOR (mammalian target of rapamycin) signaling prevents and reverses salt-induced hypertension and kidney injury in Dahl salt-sensitive rats[J]. Hypertension, 2019,73(3):630-639. doi: 10.1161/HYPERTENSIONAHA.118.12378.
doi: 10.1161/HYPERTENSIONAHA.118.12378 pmid: 30595123
[12] Howell JJ, Manning BD. mTOR couples cellular nutrient sensing to organismal metabolic homeostasis[J]. Trends Endocrinol Metab, 2011,22(3):94-102. doi: 10.1016/j.tem.2010.12.003.
doi: 10.1016/j.tem.2010.12.003 pmid: 21269838
[13] Chiou WF, Lee CH, Liao JF, et al. 8-prenylkaempferol accelerates osteoblast maturation through bone morphogenetic protein-2/p38 pathway to activate runx2 transcription[J]. Life Sci, 2011,88(7/8):335-342. doi: 10.1016/j.lfs.2010.12.009.
[14] Kim IR, Kim SE, Baek H, et al. The role of kaempferol-induced autophagy on differentiation and mineralization of osteoblastic MC3T3-E1 cells[J]. BMC Complement Altern Med, 2016 , 16(1):333. doi: 10.1186/s12906-016-1320-9.
pmid: 27581091
[15] Hamilton S, Terentyeva R, Kim TY, et al. Pharmacological modulation of mitochondrial Ca2+ content regulates sarcoplasmic reticulum Ca2+ release via oxidation of the ryanodine receptor by mitochondria-derived reactive oxygen species[J]. Front Physiol, 2018,9:1831. doi: 10.3389/fphys.2018.01831.
pmid: 30622478
[16] Ulises AC, Eduardo SP, Alenka L, et al. MTOR-independent autophagy induced by interrupted endoplasmic reticulum-mitochondrial Ca2+ communication: a dead end in cancer cells[J]. Autophagy, 2019,15(2):358-361. doi: 10.1080/15548627.2018. 1537769.
[1] WANG Min,JIANG Nan,ZHU Songsong. A novel biomimetic micro/nano hierarchical interface of titanium enhances adhesion, proliferation and osteogenic differentiation of bone marrow mesenchymal cells [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(4): 226-233.
[2] WU Zeyu,ZHAO Jin,WANG Chen,GONG Yi,XUE Rui. Prediction of the pharmacological characteristics and therapeutic mechanism of Tripterygium wilfordii in treating oral lichen planus based on network pharmacology [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(12): 809-819.
[3] LI Qi, WANG He, HUANG Zijun, HAN Qianqian. Research progress on the regulatory mechanism of estrogen in periodontal ligament cells repair and the reconstruction of periodontal tissue [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(11): 787-792.
[4] BIN Zhiwen,WANG Fang,HOU Jinsong. Research progress on the reconstruction of mandibular defects in adolescents [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(10): 711-715.
[5] QIN Qing,SONG Yang,LIU Jia,LI Qiang. Effects of casein kinase 2 interacting protein-1 on the osteogenic differentiation ability of human periodontal ligament stem cells [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(7): 421-426.
[6] PENG Haiyan,JIANG Xiaowen,HUANG Huaqing,CHEN Jinyong. The role of the mTORC1 signaling pathway during osteogenic differentiation of mouse bone marrow mesenchymal cells under tension stress [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(4): 219-223.
[7] WANG Zhiheng,ZUO Jie,WANG Mengqi,ZHU Shaojun,LIU Yishan. miR-214 inhibits the osteogenic differentiation of dental follicle cells in vitro [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(3): 146-152.
[8] LIAN Keqian,ZHANG Xin,ZHOU Jieyu,LIAO Yanfen,SI Shanshan. Biocompatibility of bone marrow mesenchymal cells on polyetheretherketone and titanium surfaces in vitro [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(2): 73-78.
[9] LIAO Dan,GE Song. Comparative study on icariin and Bu-Shen-Gu-Chi-Wan for alveolar reconstruction in chronic periodontitis in rats [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(12): 759-767.
[10] LIAO Chunhui,LI Mingfei,YE Jinmei,PENG Wei,CHEN Songling. The regulatory mechanisms of IGF1 in the osteogenic differentiation of canine MSMSCs via BMP2-Smad1/5 signaling pathway [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(1): 16-23.
[11] ZHAO Qiucheng,LIU Hanghang,HE Ze,ZHOU Yingxin,LUO En. Simultaneous distraction osteogenesis of the maxilla and mandible combined with second-stage orthognathic surgery for correction of hemifacial microsomia in adults [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(9): 569-576.
[12] JIANG Xiaowen,HUANG Huaqing,CHEN Jinyong,PENG Haiyan. Experimental study of periostin promoting rapid distraction osteogenesis of the rabbit mandible [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(9): 551-556.
[13] LI Yunfeng,ZHU Songsong. Application of digital technology in diagnosis and treatment of dentofacial deformities [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(2): 74-82.
[14] YIN Xiaoping,XIONG Huacui,CHEN Ke,HUANG Ying,XU Shuaimei. The effects of leptin on osteogenesis/odontogenic related gene expression of human apical papillary stem cells [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(1): 23-29.
[15] Jing LIU, Kai ZHAO, Xudong WANG, Wei HUANG, Feng WANG, Lan JIA, Yiqun WU. Clinical evaluation of implant-supported prostheses for edentulous patients with ectodermal dysplasia [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(7): 451-455.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
[1] ZHU Song-song, HU Jing. The application of distraction osteogenesis in the temporomandibular joint ankylosis and secondary dentofacial deformities[J]. journal1, 2016, 24(1): 6 -10 .
[2] XU Jing. The influence of the impacted mandibular third molar extraction on the distal periodontal tissue of the mandibular second molar[J]. journal1, 2016, 24(1): 11 -14 .
[3] ZHONG Jiang-long, PAN Ji-yang, CHEN Wei-liang. The evaluation of Eagle syndrome treatment by surgery combined with antidepressant therapy[J]. journal1, 2016, 24(1): 26 -28 .
[4] CHEN Xi, SUN Qin-zhou. The study of colorimetric board of porcelain fused to metal restoration for moderate to severe dental fluorosis[J]. journal1, 2016, 24(1): 33 -36 .
[5] OUYANG Ke-xiong1, LIANG Jun, ZOU Rui, LI Zhi-qiang, BAI Zhi-bao, PIAO Zheng-guo, ZHAO Jian-Jiang.. Ion Torrent RNA-Seq detection and analysis of the long non-coding RNA in tongue squamous cell carcinoma[J]. journal1, 2016, 24(1): 15 -19 .
[6] YU Pei, XUE Jing, ZHANG Xiao-wei, ZHENG Cang-shang. The influence of the roughness of zirconia ceramic surface on microbial attachment[J]. journal1, 2016, 24(1): 20 -25 .
[7] LIU Fang. Clinical assessment of two fissure sealant techniques in children’s dental caries prevention[J]. journal1, 2016, 24(1): 44 -45 .
[8] . [J]. journal1, 2016, 24(1): 49 -52 .
[9] LU Jian-rong, BAN Hua-jie, WANG Dai-you, ZHOU Hui-hui, LONG Ru, QIN Shu-hua. Clinical observation of sternocleidomastoid muscle flaps combined with artificial biological membrane reparing the defects after parotidectomy[J]. journal1, 2016, 24(1): 29 -32 .
[10] LI Bin, HE Xiao-ning, GAO Yuan, HU Yu-ping. Clinical analysis of pain after two kinds of apical stop preparation[J]. journal1, 2016, 24(1): 40 -43 .
This work is licensed under a Creative Commons Attribution 3.0 License.