Journal of Prevention and Treatment for Stomatological Diseases ›› 2021, Vol. 29 ›› Issue (5): 296-305.doi: 10.12016/j.issn.2096-1456.2021.05.002

• Basic Study • Previous Articles     Next Articles

Differential expression profile of circRNAs in oral leukoplakia

XU Siming1(),SONG Yuhan1,SHAO Yanxiong1,TAO Lan2(),ZHOU Haiwen1()   

  1. 1. Department of Oral Mucosal Diseases, Shanghai Ninth People′s Hospital, College of Stomatology, Shanghai Jiao Tong University School of Medicine, National Clinical Research Center for Oral Diseases, Shanghai Key Laboratory of Stomatology, Shanghai Research Institute of Stomatology, Shanghai 200011, China
    2. Department of General Dentistry, Shanghai Ninth People′s Hospital, College of Stomatology, Shanghai Jiao Tong University School of Medicine, National Clinical Research Center for Oral Diseases, Shanghai Key Laboratory of Stomatology, Shanghai Research Institute of Stomatology, Shanghai 200011, China
  • Received:2020-09-25 Revised:2020-12-04 Online:2021-05-20 Published:2021-03-08
  • Contact: Lan TAO,Haiwen ZHOU E-mail:xusimingmm@163.com;13917166195@139.com;haiwen39@126.com
  • Supported by:
    The National Natural Science Foundation of China(81170968)

Abstract:

Objective To investigate the differences and clinical significance of circRNA expression profiles in oral leukoplakia (OLK) tissues and normal oral mucosal (NOM) tissues. Methods High-throughput sequencing was used to detect differentially expressed circRNAs in 6 pairs of OLK and NOM tissues, and qRT-PCR was used to verify the expression of 10 circRNAs screened in 6 pairs of OLK and NOM tissues. The ring formation of circRNA was verified by RNase R digestion and Sanger sequencing, and the target circHLA-C was further verified by qRT-PCR in 20 pairs of OLK and NOM tissues. CircHLA-C was visualized using the UCSC genome browser (genome.ucsc.edu). The function of differentially expressed circRNAs was analyzed by GO and KEGG enrichment analyses. TargetScan and miRanda predicted the downstream miRNAs and mRNAs of the target circRNAs, and a ceRNA network related to the identified circRNAs was constructed in Cytoscape. Results Sequencing analysis showed that 366 circRNAs were significantly differentially expressed in OLK tissues, including 65 upregulated and 301 downregulated circRNAs. After qRT-PCR verification, 7 of the 10 screened circRNAs were expressed consistent with the sequencing results. The upregulated circHLA-C was confirmed to be a real circRNA with back-splice junction sites by RNase R digestion and Sanger sequencing. Correlation analysis showed a positive correlation between circHLA-C and the degree of OLK dysplasia. ROC curve analysis suggested that circHLA-C had potential value in diagnosing OLK with high accuracy and specificity. Conclusion CircRNA was significantly abnormally expressed in OLK tissues, and the upregulation of circHLA-C may be related to the degree of OLK dysplasia, providing guiding value for the diagnosis of OLK in the future.

Key words: circRNA, oral leukoplakia, premalignant lesion, high-throughput sequencing, differential expression profile, competing endogenous RNA, miRNA, circHLA-C, epithelial dysplasia

CLC Number: 

  • R781.5

Table 1

The clinical characteristics of patients with oral leukoplakia for sequencing"

Number Age (year) Sex Location Dysplasia degree Smoking history (No/Yes) Alcohol history (No/Yes)
1 47 Female Dorsal of the tongue Mild No No
2 61 Female Ventral of the tongue Mild No No
3 41 Male Ventral of the tongue Mild No No
4 51 Female Ventral of the tongue Mild-moderate No No
5 69 Male Ventral of the tongue Mild-moderate No Yes
6 52 Female Buccal Moderate-severe No No

Table 2

The primers used for qRT-PCR experiments"

Circular RNA Primer type Primer sequence (5’-3’)
CircHLA-C
(chr6:31238920-31324013-)
Forward CGGCAAGGATTACATCGC
Reverse CCTTCCCGTTCTCCAGGT
CircPLIN4
(chr19:4511523-4511918-)
Forward TGTGTGCAGTGGGGTGAC
Reverse CCCTTTGGCGACATTCAC
CircMTX2
(chr2:177161588-177202305+)
Forward TGACGCACTGGTATTTGGC
Reverse GCATTTTCAGGCCAAGGTT
CircRNF13
(chr3:149613260-149639014+)
Forward TGGGCATCTGTCTCATCTTG
Reverse GTCGTTGGATCCCATGCT
CircSENP2
(chr3:185293003-185344181+)
Forward CCTCAACAGCTGAATGGGA
Reverse CCCACATCTCCCCCTTCT
CircPLEKHM2
(chr1:16044388-16047883+)
Forward ACTCCGTCACCTCCACCA
Reverse CCGCAGGTAGCTCTCCAA
CircEMB
(chr5:49694941-49707217-)
Forward TGCTCAGCAGGAGCTTCA
Reverse CTGCATTCAAATCCCCAGA
CircERICH1
(chr8:618598-624047-)
Forward AAAACGCTGCTGCTCCTG
Reverse TCTTTGGCTGGTCATGAGG
CircALDH3A2
(chr17:19554860-19575269+)
Forward TCAAAGGTGGATTGGGGA
Reverse CATCCAGCATGGTGAGCA
CircZNF720
(chr16:31733947-31734674+)
Forward CGCTGTCTCTAAGCCGGA
Reverse GGTGTTCCCACTCCTCCC

Figure 1

Expression profiles of circRNAs in OLK versus NOM tissues a: hierarchical clustering analysis showed circRNA expression profles that were different between OLK tissues and NOM tissues; red represents upregulated circRNAs, and green represents downregulated circRNAs; b: scatter plot of differences in circRNA expression between OLK and NOM tissues; red represents upregulated circRNAs with FC ≥ 2.0 in OLK tissues; green represents downregulated circRNAs with FC ≥ 2.0; c: volcano plot of signifcantly dysregulated circRNAs in OLK tissues; red represents eligible circRNAs (FC ≥ 2.0; P < 0.05). OLK: oral leukoplakia; NOM: normal oral mucosal"

Figure 2

Distribution of the characteristics of significantly dysregulated circRNAs a: significantly differentially expressed circRNAs were divided into 4 types according to the host gene structure(exon, intron, antisense, and sense overlapping circRNA); b: filtered circRNAs were classified by whether they were newly discovered; c: classification according to the circRNA length; d: chromosome distribution of upregulated and downregulated signifcantly differentially expressed circRNAs"

Table 3

Ten circRNAs differentially expressed in OLK"

CircRNA ID FC P Chromosome Strand Gene name Sequence length(bp)
CircHLA-C(chr6:31238920-31324013-) 7.719 < 0.001 chr6 - HLA-C 85 094
CircPLIN4(chr19:4511523-4511918-) 5.992 0.001 chr19 - PLIN4 396
CircMTX2(chr2:177161588-177202305+) 5.980 0.003 chr2 + MTX2 40 718
CircRNF13(chr3:149613260-149639014+) 5.735 0.002 chr3 + RNF13 379
CircSENP2(chr3:185293003-185344181+) -8.583 < 0.001 chr3 + SENP2 51 179
CircPLEKHM2(chr1:16044388-16047883+) -6.122 < 0.001 chr1 + PLEKHM2 435
CircERICH1(chr8:618598-624047-) -5.917 < 0.001 chr8 - ERICH1 954
CircEMB(chr5:49694941-49707217-) -5.722 < 0.001 chr5 - EMB 12 277
CircALDH3A2(chr17:19554860-19575269+) -5.532 0.006 chr17 + ALDH3A2 1 290
CircZNF720(chr16:31733947-31734674+) -5.258 0.001 chr16 + ZNF720 223

Figure 3

Ten circRNAs differentially expressed in OLK a: ten selected circRNAs were subjected to qRT-PCR validation in 6 NOM and 6 OLK tissues; b: comparison of the results of high-throughput sequencing and qRT-PCR. c: RNase R analysis showed that circHLA-C, circPLIN4 and circRNF13 resisted digestion by RNase R; *:P < 0.05. OLK: oral leukoplakia; FC: fold change; HLA-C: human leukocyte antigen-C; PLIN4: perilipin-4; MTX2: metaxin 2; RNF13: ring finger protein 13; SENP2: sentrin/SUMO-specific proteases; PLEKHM2: pleckstrin homology and RUN domain containing M2; ERICH1: glutamate rich 1; EMB: embigin; ALDH3A2: aldehyde dehydrogenase 3 family member A2; ZNF720: zinc finger protein 720"

Figure 4

Ring formation mechanism and back spliced site of circHLA-C HLA-C: human leukocyte antigen-C"

Figure 5

KEGG analysis of the differential expression of circRNA in OLK a: top 10 in the KEGG analysis of upregulated circRNAs; b: top 10 in the KEGG analysis of downregulated circRNAs. The terms in the red frame indicate important pathways in OLK; OLK:oral leukoplakia"

Figure 6

ROC curve analysis of circHLA-C in OLK OLK: oral leukoplakia"

Figure 7

CeRNA interaction ceRNA:competing endogenous RNA"

[1] Hong WK, Endicott J, Itri LM, et al. 13-cis-retinoic acid in the treatment of oral leukoplakia[J]. N Engl J Med, 1986, 315(24): 1501-1505. doi: 10.1056/NEJM198612113152401.
doi: 10.1056/NEJM198612113152401 pmid: 3537787
[2] Memczak S, Jens M, Elefsinioti A, et al. Circular RNAs are a large class of animal RNAs with regulatory potency[J]. Nature, 2013, 495(7441): 333-338. doi: 10.1038/nature11928.
doi: 10.1038/nature11928 pmid: 23446348
[3] Bach DH, Lee SK, Sood AK. Circular RNAs in cancer[J]. Mol Ther Nucleic Acids, 2019, 16:118-129. doi: 10.1016/j.omtn.2019. 02.005.
doi: 10.1016/j.omtn.2019.02.005 pmid: 30861414
[4] Altesha MA, Ni T, Khan A, et al. Circular RNA in cardiovascular disease[J]. J Cell Physiol, 2019, 234(5): 5588-5600. doi: 10.1002/jcp.27384.
pmid: 30341894
[5] Zhong Y, Du Y, Yang X, et al. Circular RNAs function as ceRNAs to regulate and control human cancer progression[J]. Mol Cancer, 2018, 17(1): 79. doi: 10.1186/s12943-018-0827-8.
doi: 10.1186/s12943-018-0827-8 pmid: 29626935
[6] Kristensen LS, Andersen MS, Stagsted LV, et al. The biogenesis, biology and characterization of circular RNAs[J]. Nat Rev Genet, 2019, 20(11): 675-691. doi: 10.1038/s41576-019-0158-7.
doi: 10.1038/s41576-019-0158-7 pmid: 31395983
[7] Zhang X, Wang S, Wang H, et al. Circular RNA circNRIP1 acts as a microRNA-149-5p sponge to promote gastric cancer progression via the AKT1/mTOR pathway[J]. Mol Cancer, 2019, 18(1): 20. doi: 10.1186/s12943-018-0935-5.
doi: 10.1186/s12943-018-0935-5 pmid: 30717751
[8] Li X, Yang L, Biogenesis CT, et al. And challenges of circular RNAs[J]. Mol Cell, 2018, 71(3): 428-442. doi: 10.1016/j.molcel.2018.06.034.
doi: 10.1016/j.molcel.2018.06.034 pmid: 30057200
[9] Wilusz JE. A 360° view of circular RNAs: from biogenesis to functions[J]. Wiley Interdiscip Rev RNA, 2018, 9(4): e1478. doi: 10.1002/wrna.1478.
doi: 10.1002/wrna.1478 pmid: 29655315
[10] Chen B, Huang S. Circular RNA: an emerging non-coding RNA as a regulator and biomarker in cancer[J]. Cancer Lett, 2018, 418:41-50. doi: 10.1016/j.canlet.2018.01.011.
doi: 10.1016/j.canlet.2018.01.011 pmid: 29330104
[11] Xu S, Song Y, Shao Y, et al. Comprehensive analysis of circular RNA in oral leukoplakia: upregulated circHLA-C as a potential biomarker for diagnosis and prognosis[J]. Ann Transl Med, 2020, 8(21): 1375. doi: 10.21037/atm-20-3840.
doi: 10.21037/atm-20-3840 pmid: 33313120
[12] Glažar P, Papavasileiou P, Rajewsky N. CircBase: a database for circular RNAs[J]. RNA, 2014, 20(11): 1666-1670. doi: 10.1261/rna.043687.113.
doi: 10.1261/rna.043687.113
[13] Ghosal S, Das S, Sen R, et al. Circ2traits: a comprehensive database for circular RNA potentially associated with disease and traits[J]. Front Genet, 2013, 4:283. doi: 10.3389/fgene.2013.00283.
doi: 10.3389/fgene.2013.00283 pmid: 24339831
[14] Li Z, Gao M, Liu C, et al. Immunohistochemical detection of aurora a and ERK pathway in oral leukoplakia and oral squamous cell carcinoma[J]. J Hard Tissue Biol, 2014, 23(1): 71-76. doi: 10.2485/jhtb.23.71.
[15] Yang W, Wang XM, Yuan HY, et al. Exploring the mechanism of WWOX growth inhibitory effects on oral squamous cell carcinoma[J]. Oncol Lett, 2017, 13(5): 3198-3204. doi: 10.3892/ol.2017.5850.
doi: 10.3892/ol.2017.5850 pmid: 28521426
[16] Neville BW, Day TA. Oral cancer and precancerous lesions[J]. CA Cancer J Clin, 2002, 52(4): 195-215. doi: 10.3322/canjclin.52. 4.195.
doi: 10.3322/canjclin.52.4.195 pmid: 12139232
[17] Brouns E, Baart J, Karagozoglu K, et al. Malignant transformation of oral leukoplakia in a well-defined cohort of 144 patients[J]. Oral Dis, 2014, 20(3): e19-e24. doi: 10.1111/odi.12095.
doi: 10.1111/odi.12095 pmid: 23521625
[18] Cocquerelle C, Mascrez B, Hétuin D, et al. Mis-splicing yields circular RNA molecules[J]. FASEB J, 1993, 7(1): 155-160.
doi: 10.1096/fasebj.7.1.7678559 pmid: 7678559
[19] Zheng Q, Bao C, Guo W, et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs[J]. Nat Commun, 2016, 7(1): 11215. doi: 10.1038/ncomms11215.
[20] Wang YF, Li BW, Sun S, et al. Circular RNA expression in oral squamous cell carcinoma[J]. Front Oncol, 2018, 8:398. doi: 10.3389/fonc.2018.00398.
[21] Qiu X, Ke X, Ma H, et al. Profiling and bioinformatics analyses reveal differential expression of circular RNA in tongue cancer revealed by high-throughput sequencing[J]. J Cell Biochem, 2019, 120(3): 4102-4112. doi: 10.1002/jcb.27695.
doi: 10.1002/jcb.27695 pmid: 30269358
[22] Chen X, Yu J, Tian H, et al. Circle RNA hsa_circRNA_100290 serves as a ceRNA for miR-378a to regulate oral squamous cell carcinoma cells growth via Glucose transporter-1 (GLUT1) and glycolysis[J]. J Cell Physiol, 2019, 234(11): 19130-19140. doi: 10.1002/jcp.28692.
doi: 10.1002/jcp.28692 pmid: 31187488
[23] Wang L, Wei Y, Yan Y, et al. CircDOCK1 suppresses cell apoptosis via inhibition of miR-196a-5p by targeting BIRC3 in OSCC[J]. Oncol Rep, 2018, 39(3): 951-966. doi: 10.3892/or.2017.6174.
doi: 10.3892/or.2017.6174 pmid: 29286141
[24] Su W, Wang Y, Wang F, et al. Circular RNA hsa_circ_0007059 indicates prognosis and influences malignant behavior via AKT/mTOR in oral squamous cell carcinoma[J]. J Cell Physiol, 2019, 234(9): 15156-15166. doi: 10.1002/jcp.28156.
[25] Ju H, Zhang L, Mao L, et al. Altered expression pattern of circular RNAs in metastatic oral mucosal melanoma[J]. Am J Cancer Res, 2018, 8(9): 1788-1800.
pmid: 30323971
[26] Li Z, Huang C, Bao C, et al. Exon-intron circular RNAs regulate transcription in the nucleus[J]. Nat Struct Mol Biol, 2015, 22(3): 256-264. doi: 10.1038/nsmb.2959.
[27] Kaur G, Gras S, Mobbs J, et al. Structural and regulatory diversity shape HLA-C protein expression levels[J]. Nat Commun, 2017, 8:15924. doi: 10.1038/ncomms15924.
doi: 10.1038/ncomms15924 pmid: 28649982
[28] Dutta A, Saikia N, Phookan J, et al. Association of killer cell immunoglobulin-like receptor gene 2DL1 and its HLA-C2 ligand with family history of cancer in oral squamous cell carcinoma[J]. Immunogenetics, 2014, 66(7/8): 439-448. doi: 10.1007/s00251-014-0778-1.
[29] 吴平凡, 韩帮锋, 夏辉, 等. 人类主要组织相容抗原Ⅰ类分子在口腔白斑中表达的临床意义[J]. 华西口腔医学杂志, 2010, 28(4): 439-442.
pmid: 20848943
Wu PF, Han BF, Xia H, et al. The expression of human major histocompatibility complex-I in oral leukoplakia[J]. Hua Xi Kou Qiang Yi Xue Za Zhi, 2010, 28(4): 439-442.
pmid: 20848943
[30] Prime SS, Pitigala-Arachchi A, Crane IJ, et al. The expression of cell surface MHC class I heavy and light chain molecules in pre-malignant and malignant lesions of the oral mucosa[J]. Histopathology, 1987, 11(1): 81-91. doi: 10.1111/j.1365-2559.1987.tb02611.x.
pmid: 3549515
[31] Ohman J, Magnusson B, Telemo E, et al. Langerhans cells and T cells sense cell dysplasia in oral leukoplakias and oral squamous cell carcinomas--evidence for immunosurveillance[J]. Scand J Immunol, 2012, 76(1): 39-48. doi: 10.1111/j.1365-3083.2012.02701.x.
doi: 10.1111/j.1365-3083.2012.02701.x pmid: 22469080
[32] Liang YW, Zhang YZ, Xu LA, et al. CircRNA expression pattern and ceRNA and miRNA-mRNA networks involved in anther development in the CMS line of brassica campestris[J]. Int J Mol Sci, 2019, 20(19): 4808. doi: 10.3390/ijms20194808.
[33] Sun L, Liu L, Fu H, et al. Association of decreased expression of serum miR-9 with poor prognosis of oral squamous cell carcinoma patients[J]. Med Sci Monit, 2016, 22:289-294. doi: 10.12659/msm.895683.
doi: 10.12659/msm.895683 pmid: 26813876
[34] Maimaiti A, Abudoukeremu K, Tie L, et al. MicroRNA expression profiling and functional annotation analysis of their targets associated with the malignant transformation of oral leukoplakia[J]. Gene, 2015, 558(2): 271-277. doi: 10.1016/j.gene.2015.01.004.
doi: 10.1016/j.gene.2015.01.004 pmid: 25576219
[35] Zhang L, Lu XQ, Zhou XQ, et al. NEAT1 induces osteosarcoma development by modulating the miR-339-5p/TGF-β1 pathway[J]. J Cell Physiol, 2019, 234(4): 5097-5105. doi: 10.1002/jcp.27313.
doi: 10.1002/jcp.27313 pmid: 30203547
[36] Roy R, Singh R, Chattopadhyay E, et al. MicroRNA and target gene expression based clustering of oral cancer, precancer and normal tissues[J]. Gene, 2016, 593(1): 58-63. doi: 10.1016/j.gene.2016.08.011.
doi: 10.1016/j.gene.2016.08.011 pmid: 27515006
[37] Chang Y, Weng SL, Yang SF, et al. A three-microRNA signature as a potential biomarker for the early detection of oral cancer[J]. Int J Mol Sci, 2018, 19(3): 758. doi: 10.3390/ijms19030758.
[1] WANG Yanfeng,ZENG Jiajun,YUAN Qiao,LUAN Qingxian. Influence of mechanical debridement on the subgingival microbiome in chronic periodontitis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(6): 368-376.
[2] LI Peihan,LANG Kai,SONG Wen. Construction of a curcumin-siRNA co-delivery system based on mesoporous silica and its effect on M2-type polarization of macrophages [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(5): 306-313.
[3] YANG Wanjuan,XU Jie. High-throughput sequencing analysis of the microbiota of subgingival plaque in patients with periodontitis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(3): 157-165.
[4] WANG Guangchao,LIU Lijun,JIANG Weiwen. Significance of phosphoinositol metabolism by DNA methylation may contribute in oral leukoplakia carcinogenesis [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(10): 677-683.
[5] ZENG Fantao,YU Dongsheng. Knockdown of circ_0001273 inhibits the proliferation, migration and invasion of oral squamous cell carcinoma cells [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(3): 153-157.
[6] TONG Ting,CHENG Lei,REN Biao. Research progress on the relationship between Candida albicans and oral potentially malignant disorders [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(12): 806-810.
[7] Pengyu HONG,Jiaxiong GAO,Dianri WANG,Zhangui TANG. White sponge nevus: a case report and literature review [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(7): 464-467.
[8] Xinyu LIN,Weixiong CHEN,Xinyuan LEI,Zhanpeng OU,song FAN,Jinsong LI. Screening and identification of mitochondrial miRNAs related to chemotherapy resistance in tongue squamous cell carcinoma [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(7): 417-422.
[9] XIAO Xiaofen,HE Shandan,CHEN Yongyi,WU Xiaoyun,ZHENG Yuyan. Study on the dental plaque microbial community in preschool children with different caries sensitivity [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(12): 763-768.
[10] Bing-hui ZENG, Dong-sheng YU. Research progress of circular RNA and its research prospects in oral diseases [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2017, 25(2): 123-128.
[11] Zhen ZHANG,Hong-yu ZHAO. Chronic periodontitis and its related microRNA [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(6): 378-380.
[12] OUYANG Ke-xiong1, LIANG Jun, ZOU Rui, LI Zhi-qiang, BAI Zhi-bao, PIAO Zheng-guo, ZHAO Jian-Jiang.. Ion Torrent RNA-Seq detection and analysis of the long non-coding RNA in tongue squamous cell carcinoma [J]. journal1, 2016, 24(1): 15-19.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
[1] ZHU Song-song, HU Jing. The application of distraction osteogenesis in the temporomandibular joint ankylosis and secondary dentofacial deformities[J]. journal1, 2016, 24(1): 6 -10 .
[2] XU Jing. The influence of the impacted mandibular third molar extraction on the distal periodontal tissue of the mandibular second molar[J]. journal1, 2016, 24(1): 11 -14 .
[3] ZHONG Jiang-long, PAN Ji-yang, CHEN Wei-liang. The evaluation of Eagle syndrome treatment by surgery combined with antidepressant therapy[J]. journal1, 2016, 24(1): 26 -28 .
[4] CHEN Xi, SUN Qin-zhou. The study of colorimetric board of porcelain fused to metal restoration for moderate to severe dental fluorosis[J]. journal1, 2016, 24(1): 33 -36 .
[5] OUYANG Ke-xiong1, LIANG Jun, ZOU Rui, LI Zhi-qiang, BAI Zhi-bao, PIAO Zheng-guo, ZHAO Jian-Jiang.. Ion Torrent RNA-Seq detection and analysis of the long non-coding RNA in tongue squamous cell carcinoma[J]. journal1, 2016, 24(1): 15 -19 .
[6] YU Pei, XUE Jing, ZHANG Xiao-wei, ZHENG Cang-shang. The influence of the roughness of zirconia ceramic surface on microbial attachment[J]. journal1, 2016, 24(1): 20 -25 .
[7] LIU Fang. Clinical assessment of two fissure sealant techniques in children’s dental caries prevention[J]. journal1, 2016, 24(1): 44 -45 .
[8] . [J]. journal1, 2016, 24(1): 49 -52 .
[9] LU Jian-rong, BAN Hua-jie, WANG Dai-you, ZHOU Hui-hui, LONG Ru, QIN Shu-hua. Clinical observation of sternocleidomastoid muscle flaps combined with artificial biological membrane reparing the defects after parotidectomy[J]. journal1, 2016, 24(1): 29 -32 .
[10] LI Bin, HE Xiao-ning, GAO Yuan, HU Yu-ping. Clinical analysis of pain after two kinds of apical stop preparation[J]. journal1, 2016, 24(1): 40 -43 .
This work is licensed under a Creative Commons Attribution 3.0 License.