Journal of Prevention and Treatment for Stomatological Diseases ›› 2021, Vol. 29 ›› Issue (12): 801-808.doi: 10.12016/j.issn.2096-1456.2021.12.002

• Basic Study • Previous Articles     Next Articles

Construction of the hit-deficient mutant strain of Streptococcus mutans ATCC25175

LAI Yangfan1(),WANG Peng1,QIAO Li2,LIU Zhongjing2,YE Zhaoyang2(),LIANG Yan1()   

  1. 1. Department of Operative Dentistry and Endodontics, School of Stomatology, Guizhou Medical University, Guiyang 550004, China
    2. Clinical Research Center (Affiliated Hospital), Guizhou Medical University, Guiyang 550004, China
  • Received:2021-02-02 Revised:2021-04-23 Online:2021-12-20 Published:2021-08-17
  • Contact: Zhaoyang YE,Yan LIANG E-mail:1392559217@qq.com;yezy@gmc.edu.cn;519573688@qq.com
  • Supported by:
    grants from Guizhou Science and Technology Fund(ZK[2021]438);Guizhou Health Science and Technology Fund(gzwjkj2019-1-172)

RichHTML

PDF (PC)

Abstract:

Objective To construct a hit-deficient mutant strain of S. mutans ATCC25175 and verify its cell cycle regulatory function. Method Genomic DNA was extracted from S. mutans ATCC25175 strains, and then the upstream and downstream DNA fragments of the hit gene were cloned into the pFW5 vector (spectinomycin resistant) to construct recombinant plasmids using PCR amplification. Third, employed by natural genetic transformation in S. mutans ATCC25175 strains, the linearized recombinant plasmids were transformed into their genetic competence, induced by the synthesized competence-stimulating peptide (CSP), and then, homologous recombination was utilized to produce crossover and noncrossover products. Fourth, the hit-deficient mutant strains of S. mutans ATCC25175 were screened through the spectinomycin-resistance marker and identified by the electrophoresis of PCR products and PCR Sanger sequencing. Finally, its growth rate in vegetative BHI medium was also investigated. Results The upstream (856 bp) and downstream (519 bp) DNA fragments of the hit gene from the genomic DNA materials of S. mutans ATCC25175 were cloned into two multiple cloning sites (MCS-I and MCS-II) of the pFW5 vector, respectively, and the recombinant plasmid pFW5_hit_Up_Down was constructed and identified by double-emzyme digestion and PCR Sanger sequencing. The linearized recombinant plasmids were transformed into their genetic competence, induced by the synthetic CSP, and then, homologous recombination was utilized to produce various products. The hit-deficient mutant strains of S. mutans ATCC25175 were screened through the spectinomycin resistance marker and identified by the electrophoresis of PCR products and Sanger sequencing. The growth rate of the hit-deficient mutant strains versus their parental S. mutans ATCC25175 strains was increased greatly (P<0.001). Conclusion The hit-deficient mutant strains of S. mutans ATCC25175, having heritable traits, were successfully constructed, and the encoding Hit protein is growth-phase regulated in the cell cycle.

Key words: Streptococcus mutans, hit gene, pFW5 vector, natural genetic transformation, homologous recombination, hit-deficient mutant strain, cell growth, cell-cycle regulation

CLC Number: 

  • R78

Table 1

Primers and sequences used in the experiment"

Primers Sequence （5′-3′)
hit（Up) F：CCGCTCGAGTCAACCCTCTTTAGTCAAAGTCATAT（XhoI)
R：CCCAAGCTTGTCCTCATAAACTTTTGATAGAGGGAATGT（HindIII)
hit（Down) F：GGAATTCCATATGCCTGACTTTACCCGTCTTGGACAAT（NdeI)
R：GGACTAGTAAATAAAAAATAAGGTGGAAGGGTAT（SpeI)
pFW5（PCR) F：AGGATGAGGAGGCAGATTGCCTTGAATAT
R1：ATTCCTCTGACGAATCCATAATGGCTCTT
F1：ATATACGGAAATTATGACTTAGAGGAATT
R：CGCAGCGAGAAAAAAGGCCCACTTTTGT
hit（PCR) F：CATGACGTTTCTTTCTAACTTTGATAT
R：GTTTGTAATACATCTGATAAAGACCGGCT

Figure 1

Electrophoresis of PCR products of the upstream and downstream sequences of the hit gene and the circle map of the pFW5 vector a: DNA electrophoresis of PCR products of the upstream and downstream DNA fragments of the hit gene; M: marker; Up: the upstream DNA fragment of approximately 850 bp; Down: the downstream DNA fragment of approximately 500 bp; b: the vector pFW5 carries two multiple cloning sites, MCS-I and MCS-II, which are separated by the aad9 spectinomycin-resistance gene sequence"

Figure 2

Electrophoresis of PCR- and double digested-products of the recombinant plasmid pFW5 a: DNA electrophoresis of the PCR products of the MCS-Ⅰ- and MCS-Ⅱ- region DNA fragments of the recombinant plasmids pFW5 (20# and 141#); b: DNA electrophoresis of the products (20_x/s and 141_x/s) of the recombinant plasmids pFW5 (20# and 141#) digested by XhoI and SpeI. The pFW5 vector and pFW5_x/s served as the control. M: Marker"

Figure 3

DNA electrophoresis of PCR products of the hit gene DNA fragments from the Streptococcus mutans genome of plasmid (20#) genetic transformation Lanes 20-3, 20-4 to 20-24 correspond to 19 random positive colony forming units on an aad9 spectinomycin-resistant BHI agar plate, respectively"

Figure 4

Electrophoresis and Sanger sequencing of PCR products of the hit gene fragment from the hit-deficient mutant strains and their parental S. mutans ATCC25175 a: DNA electrophoresis of PCR products of the hit gene DNA fragments of the 20-3# and 20-5# strains; b: Sanger forward sequencing chromatograms of the PCR products of 20-3# strain (the top panel) and its parent strain ATCC25175 (the down panel); c: DNA electrophoresis of the PCR products of the hit gene DNA fragments of Streptococcus mutans ATCC25175; d: Sanger reversed sequencing chromatograms of the PCR products of 20-3# strain (the top panel) and its parent strain ATCC25175 (the down panel) "

Figure 5

Electrophoresis and Sanger sequencing chromatograms of the PCR products of the hit gene DNA fragments from the hit-deficient mutant strains a: DNA electrophoresis of PCR products of the hit gene DNA fragments of the 1-1-1-15 and 6-1 strains. b&c: sanger forward sequencing (b) and reversed sequencing chromatograms (c) of the PCR products of 6-1 strains"

Figure 6

Growth curve and growth rate of the hit-deficient mutant strains versus Streptococcus mutans a: the hit-deficient mutant strains (Smu.Δhit) and their parent strains ATCC25175 have similar growth curves; b: the growth rate of the hit-deficient mutant strains (Smu.Δhit) is much faster than that of their parent strains ATCC25175 at 48-hour intervals"

[1] Banas JA, Takanami E, Hemsley RM, et al. Evaluating the relationship between acidogenicity and acid tolerance for oral streptococci from children with or without a history of caries[J]. J Oral Microbiol, 2020, 12(1):1688449. doi: 10.1080/20002297.2019.1688449.
doi: 10.1080/20002297.2019.1688449
[2] Rainey K, Michalek SM, Wen ZT, et al. Glycosyltransferase-mediated biofilm matrix dynamics and virulence of Streptococcus mutans[J]. Appl Environ Microbiol, 2019, 85(5):e02218-e02247. doi: 10.1128/AEM.02247-18.
[3] Senpuku H, Yonezawa H, Yoneda S, et al. SMU.940 regulates dextran-dependent aggregation and biofilm formation in Streptococcus mutans[J]. Mol Oral Microbiol, 2018, 33(1):47-58. doi: 10.1111/omi.12196.
doi: 10.1111/omi.2018.33.issue-1
[4] Takashima Y, Fujita K, Ardin AC, et al. Characterization of the dextran-binding domain in the glucan-binding protein C of Streptococcus mutans[J]. J Appl Microbiol, 2015, 119(4):1148-1157. doi: 10.1111/jam.12895.
doi: 10.1111/jam.12895 pmid: 26176557
[5] De A, Liao S, Bitoun JP, et al. Deficiency of RgpG causes major defects in cell division and biofilm formation, and deficiency of LytR-CpsA-Psr family proteins leads to accumulation of cell wall antigens in culture medium by Streptococcus mutans[J]. Appl Environ Microbiol, 2017, 83(17):e00917-e00928. doi: 10.1128/AEM.00928-17.
[6] Bitoun JP, Liao S, Yao X, et al. BrpA is involved in regulation of cell envelope stress responses in Streptococcus mutans[J]. Appl Environ Microbiol, 2012, 78(8):2914-2922. doi: 10.1128/AEM.07823-11.
doi: 10.1128/AEM.07823-11
[7] Lima CD, Klein MG, Hendrickson WA. Structure-based analysis of catalysis and substrate definition in the HIT protein family[J]. Science, 1997, 278(5336):286-290. doi: 10.1126/science.278.5336.286.
pmid: 9323207
[8] Podbielski A, Spellerberg B, Woischnik M, et al. Novel series of plasmid vectors for gene inactivation and expression analysis in group A Streptococci (GAS)[J]. Gene, 1996, 177(1/2):137-147. doi: 10.1016/0378-1119(96)84178-3.
doi: 10.1016/0378-1119(96)84178-3
[9] Li YH, Lau PC, Lee JH, et al. Natural genetic transformation of Streptococcus mutans growing in biofilms[J]. J Bacteriol, 2001, 183(3):897-908. doi: 10.1128/JB.183.3.897-908.2001.
pmid: 11208787
[10] Chatfield CH, Koo H, Quivey RG. The putative autolysin regulator LytR in Streptococcus mutans plays a role in cell division and is growth-phase regulated[J]. Microbiology, 2005, 151(Pt 2):625-631. doi: 10.1099/mic.0.27604-0.
doi: 10.1099/mic.0.27604-0
[11] Attaiech L, Charpentier X. Silently transformable: the many ways bacteria conceal their built-in capacity of genetic exchange[J]. Curr Genet, 2017, 63(3):451-455. doi: 10.1007/s00294-016-0663-6.
doi: 10.1007/s00294-016-0663-6
[12] Lam T, Brennan MD, Morrison DA, et al. Femtoliter droplet confinement of Streptococcus pneumoniae: bacterial genetic transformation by cell-cell interaction in droplets[J]. Lab Chip, 2019, 19(4):682-692. doi: 10.1039/c8lc01367e.
doi: 10.1039/C8LC01367E
[13] Saak CC, Dinh CB, Dutton RJ. Experimental approaches to tracking mobile genetic elements in microbial communities[J]. FEMS Microbiol Rev, 2020, 44(5):606-630. doi: 10.1093/femsre/fuaa025.
doi: 10.1093/femsre/fuaa025
[14] Aspar JR, Walker AR. Expanding the vocabulary of peptide signals in Streptococcus mutans[J]. Front Cell Infect Microbiol, 2019, 9:194. doi: 10.3389/fcimb.2019.00194.
doi: 10.3389/fcimb.2019.00194
[15] Fontaine L, Wahl A, Fléchard M, et al. Regulation of competence for natural transformation in Streptococci[J]. Infect Genet Evol, 2015, 33(33):343-360. doi: 10.1016/j.meegid.2014.09.010.
doi: 10.1016/j.meegid.2014.09.010
[16] Shanker E, Federle MJ. Quorum sensing regulation of competence and bacteriocins in Streptococcus pneumoniae and mutans[J]. Genes (Basel), 2017, 8(1):15. doi: 10.3390/genes8010015.
doi: 10.3390/genes8010015
[17] Dufour D, Mankovskaia A, Chan Y, et al. A tripartite toxin-antitoxin module induced by quorum sensing is associated with the persistence phenotype in Streptococcus mutans[J]. Mol Oral Microbiol, 2018, 33(6):420-429. doi: 10.1111/omi.12245.
doi: 10.1111/omi.2018.33.issue-6
[18] Salvadori G, Junges R, Khan R, et al. Natural transformation of oral Streptococci by use of synthetic pheromones[J]. Methods Mol Biol, 2017, 1537:219-232. doi: 10.1007/978-1-4939-6685-1_13.
pmid: 27924597
[1] WU Ju,WANG Ling,LIU Xingrong. Inhibitory effect of baicalin on Streptococcus mutans UA159 in vitro [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(7): 462-467.
[2] LI Yuhan,LI Jiaxin,ZHANG Shiming,ZHANG Yaohua,LI Yuqing,ZENG Jumei. Research progress on Streptococcus mutans phages in the prevention of dental caries [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2021, 29(3): 184-188.
[3] HE Yuanli,REN Biao,CHEN Xuan,ZOU Ling. Mechanism research of srtA gene on the oxidation tolerance of Streptococcus mutans [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(5): 292-297.
[4] PENG Xinyu,PENG Xian,CHENG Lei. Research progress on the effect of pH-sensitive drug delivery systems on oral microorganisms [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2020, 28(3): 189-194.
[5] WANG Zheng,CHENG Lei,ZHOU Xuedong,REN Biao. Research progress on the mechanism of radiocaries formation [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(4): 255-259.
[6] YANG Ting,ZHANG Wanting,LI Beibei,DONG Ying,CAO Hongfei,ZHAO Jin. Distribution of oral Streptococcus mutans and its correlation with dental caries in children of Bortala Mongolian Autonomous Prefecture [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(4): 219-225.
[7] WU Zhengxi,LI Fenglan. Effect of two aging methods on the bonding interface between glass ceramics and dentin [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2019, 27(11): 703-710.
[8] Yi TAN,Sui MAI,Jia LIU,Lisha GU. Antibacterial activity of the nisin-containing single-bond universal adhesive [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(9): 557-563.
[9] Ru ZHANG, Lei LEI, Yingming YANG, Tao HU. Regulation mechanism of rnc gene on Streptococcus mutans environmental tolerance and its mechanism [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(8): 504-507.
[10] Yan-fei CHENG,Yong-rong ZHONG. Study of the cellular growth inhibited by tetrandrine with the expression of β-catenin in oral squamous cell carcinoma cell line [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(8): 464-468.
[11] Hai-xia LIU,Xuan CHEN,Ling ZOU. An in vitro evaluation of antibacterial properties of 2 pulp capping materials [J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(10): 578-581.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
[1] . [J]. journal1, 2016, 24(1): 58 -60 .
[2] Juan LI,Ting HUANG,Wen XUE,Hai-yan LI. Clinical efficacy of basic periodontal therapy combined with local medication for erosive oral lichen planus[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(3): 162 -165 .
[3] Jian-na ZHANG,Shao-hai CHANG,Yu-shan YE,Ying-juan LU. Initial stability analysis of the torque-resisted orthodontic miniscrew anchorage[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(3): 137 -141 .
[4] Ming CHEN,Xi CHEN,Zhen-ting ZHANG. The precision comparison of the denture occlusal plane preparation by the occlusal plane plate between experienced and newly-graduated dentists[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(3): 173 -176 .
[5] Zhong-juan TAN,Yue-ping ZHAO,Yuan-yuan LUO. The research progress of dental pulp regeneration[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(6): 374 -377 .
[6] Lan LIAO, Lijun ZENG. Updated research on digitalization in aesthetic restoration[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(7): 409 -414 .
[7] LI Chun,LI Yan-hong,LIU Juan. Application of probiotics for dental caries prevention in children[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(9): 558 -560 .
[8] Mingyu SUN, Hanjiang WU. Research progresses in occult lymph node metastasis of oral squamous cancer[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2018, 26(1): 61 -65 .
[9] Qian-qian HAN,Zhao LIU,Li JIANG,Hui-yi TANG,Xiao-na LI. Effects of LMK-235 on osteoblast/odontoblast differentiation in hPDLCs[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(7): 390 -394 .
[10] Nu MI,Ying GUO,Xiao-yu YANG. Clinical evaluation of anterior teeth aesthetic restoration with thin porcelain laminate veneer[J]. Journal of Prevention and Treatment for Stomatological Diseases, 2016, 24(10): 589 -593 .

Copyright © Editorial Board of Journal of Prevention and Treatment for Stomatological Diseases

This work is licensed under a Creative Commons Attribution 3.0 License.

Address:Guangzhou City Jiangnan Road South 366, Editorial office ofJournal of Prevention and Treatment for Stomatological Diseases, zip code: 510280　Fax:020-34304115
E-mail：kqjbfz@vip.126.com

Supported by:Beijing Magtech

This work is licensed under a Creative Commons Attribution 3.0 License.